Transcript: Mouse NM_001346518.1

Mus musculus RIKEN cDNA 5330417C22 gene (5330417C22Rik), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-04-24
Taxon:
Mus musculus (mouse)
Gene:
5330417C22Rik (229722)
Length:
5881
CDS:
94..3135

Additional Resources:

NCBI RefSeq record:
NM_001346518.1
NBCI Gene record:
5330417C22Rik (229722)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001346518.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283461 GGTGGCTGGTGACCACATTTA pLKO_005 1449 CDS 100% 13.200 9.240 N 5330417C22Rik n/a
2 TRCN0000346055 TTCCACAGTGTTGAGCTAAAT pLKO_005 781 CDS 100% 13.200 9.240 N 5330417C22Rik n/a
3 TRCN0000345995 CCTTATCAGAAGTTTGGATTT pLKO_005 3253 3UTR 100% 10.800 7.560 N 5330417C22Rik n/a
4 TRCN0000263310 GGGATCCAGAAGACTACTTAC pLKO_005 2713 CDS 100% 10.800 7.560 N KIAA1324 n/a
5 TRCN0000346011 GGGATCCAGAAGACTACTTAC pLKO_005 2713 CDS 100% 10.800 7.560 N 5330417C22Rik n/a
6 TRCN0000346003 GTCGCCAAGATCTACTCAATC pLKO_005 1798 CDS 100% 10.800 7.560 N 5330417C22Rik n/a
7 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3692 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346518.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12361 pDONR223 100% 80.1% 82.6% None (many diffs) n/a
2 ccsbBroad304_12361 pLX_304 0% 80.1% 82.6% V5 (many diffs) n/a
3 TRCN0000491786 TGGTACGGCATCTGGCAAGCATCC pLX_317 13% 80.1% 82.6% V5 (many diffs) n/a
4 ccsbBroadEn_14232 pDONR223 100% 57.1% 58.7% None (many diffs) n/a
5 TRCN0000492161 AGTGCTACATCAAGCCTTATCGAT pLX_317 18.5% 57.1% 58.7% V5 (many diffs) n/a
Download CSV