Transcript: Mouse NM_001346525.1

Mus musculus mbt domain containing 1 (Mbtd1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Mbtd1 (103537)
Length:
5459
CDS:
293..2161

Additional Resources:

NCBI RefSeq record:
NM_001346525.1
NBCI Gene record:
Mbtd1 (103537)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001346525.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097657 CGTGTAGGAATGAAATTAGAA pLKO.1 1844 CDS 100% 5.625 7.875 N Mbtd1 n/a
2 TRCN0000323082 GGAAGCTATAGACCCATTAAA pLKO_005 1537 CDS 100% 15.000 10.500 N MBTD1 n/a
3 TRCN0000323084 TGGATTTATGTGCATTGTTAA pLKO_005 2608 3UTR 100% 13.200 9.240 N MBTD1 n/a
4 TRCN0000097655 GCAGGATTGAAGGAAATGATT pLKO.1 2675 3UTR 100% 5.625 3.938 N Mbtd1 n/a
5 TRCN0000097658 GAGATCAGATATTACGAAGAA pLKO.1 1423 CDS 100% 4.950 3.465 N Mbtd1 n/a
6 TRCN0000097659 GCAATATATGTGGGTCTGATA pLKO.1 1032 CDS 100% 4.950 3.465 N Mbtd1 n/a
7 TRCN0000097656 CCGTCTCTTGAGGATACATTT pLKO.1 1924 CDS 100% 13.200 7.920 N Mbtd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346525.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12084 pDONR223 100% 61.4% 63.3% None (many diffs) n/a
2 ccsbBroad304_12084 pLX_304 0% 61.4% 63.3% V5 (many diffs) n/a
3 TRCN0000479991 GTTTCTTTAGCCCCGACTGTGCAG pLX_317 25.9% 61.4% 63.3% V5 (many diffs) n/a
Download CSV