Transcript: Human NM_001346558.2

Homo sapiens fidgetin like 1 (FIGNL1), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
FIGNL1 (63979)
Length:
10709
CDS:
1082..2773

Additional Resources:

NCBI RefSeq record:
NM_001346558.2
NBCI Gene record:
FIGNL1 (63979)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001346558.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000156826 GCTACCATAACACCGGATCAA pLKO.1 2633 CDS 100% 4.950 6.930 N FIGNL1 n/a
2 TRCN0000153263 GCAGAAGAATTACTTCGCAAT pLKO.1 905 5UTR 100% 4.050 5.670 N FIGNL1 n/a
3 TRCN0000157333 CCGTGCACAGATATTACGCAT pLKO.1 965 5UTR 100% 2.640 3.696 N FIGNL1 n/a
4 TRCN0000431619 AGCCAGGAAACAGATAGTAAT pLKO_005 2461 CDS 100% 13.200 9.240 N FIGNL1 n/a
5 TRCN0000413731 CCTGATACGTAAGCCTATTTG pLKO_005 2960 3UTR 100% 13.200 9.240 N FIGNL1 n/a
6 TRCN0000156259 CCGGAGAGCAATCGTTTGAAA pLKO.1 1277 CDS 100% 5.625 3.938 N FIGNL1 n/a
7 TRCN0000155467 GCCTGTAATACTGCTCTCTTT pLKO.1 3424 3UTR 100% 4.950 2.970 N FIGNL1 n/a
8 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 804 5UTR 100% 4.950 2.475 Y ERAP2 n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 805 5UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346558.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03914 pDONR223 100% 83.5% 83.5% None 0_1ins333 n/a
2 ccsbBroad304_03914 pLX_304 0% 83.5% 83.5% V5 0_1ins333 n/a
3 TRCN0000469560 TATGCTAAACGCTTGCATTCGAGT pLX_317 19.1% 83.5% 83.5% V5 0_1ins333 n/a
4 ccsbBroadEn_08823 pDONR223 100% 83.4% 83.3% None 0_1ins333;76G>A n/a
5 ccsbBroad304_08823 pLX_304 0% 83.4% 83.3% V5 0_1ins333;76G>A n/a
6 TRCN0000468624 CTTTTTTCTTTAGGTGCCTGTCTA pLX_317 20.3% 83.4% 83.3% V5 0_1ins333;76G>A n/a
Download CSV