Transcript: Mouse NM_001346774.1

Mus musculus HID1 domain containing (Hid1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Hid1 (217310)
Length:
3290
CDS:
148..2511

Additional Resources:

NCBI RefSeq record:
NM_001346774.1
NBCI Gene record:
Hid1 (217310)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001346774.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125420 GCCCAACTACATCCATGACAT pLKO.1 729 CDS 100% 4.950 6.930 N Hid1 n/a
2 TRCN0000125421 GCAGATTTGCTCATTGTGGTA pLKO.1 1519 CDS 100% 2.640 2.112 N Hid1 n/a
3 TRCN0000125422 CAGTACCAGTTTGATGGCAAT pLKO.1 1765 CDS 100% 4.050 2.835 N Hid1 n/a
4 TRCN0000125423 CCAGTACCAGTTTGATGGCAA pLKO.1 1764 CDS 100% 2.640 1.848 N Hid1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346774.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09949 pDONR223 100% 88.7% 95.5% None (many diffs) n/a
2 ccsbBroad304_09949 pLX_304 0% 88.7% 95.5% V5 (many diffs) n/a
3 TRCN0000491361 ACCGCTAGATCAATTTGGGCTTGA pLX_317 13.5% 88.7% 95.5% V5 (many diffs) n/a
Download CSV