Transcript: Mouse NM_001346804.1

Mus musculus CDC42 binding protein kinase alpha (Cdc42bpa), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-04-15
Taxon:
Mus musculus (mouse)
Gene:
Cdc42bpa (226751)
Length:
8947
CDS:
351..5510

Additional Resources:

NCBI RefSeq record:
NM_001346804.1
NBCI Gene record:
Cdc42bpa (226751)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145566 AAAACTGTAGGAACTAGTCC pXPR_003 AGG 1654 32% 13 0.5588 Cdc42bpa CDC42BPA 75746
2 BRDN0001147767 CAACATAATAATCCATAACC pXPR_003 AGG 458 9% 5 0.5271 Cdc42bpa CDC42BPA 75748
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001346804.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360802 AGCCCGACAGATACGTCAAAT pLKO_005 1440 CDS 100% 13.200 18.480 N Cdc42bpa n/a
2 TRCN0000022979 CCAGGATGACAATAACTTATA pLKO.1 782 CDS 100% 13.200 18.480 N LOC381309 n/a
3 TRCN0000022679 GCCCGACAGATACGTCAAATT pLKO.1 1441 CDS 100% 13.200 18.480 N Cdc42bpa n/a
4 TRCN0000022971 GTCTTTACGATGAATGCAATA pLKO.1 460 CDS 100% 10.800 15.120 N LOC329302 n/a
5 TRCN0000022980 GATAAAGTATTCGCCATGAAA pLKO.1 648 CDS 100% 5.625 7.875 N LOC381309 n/a
6 TRCN0000022680 GCCGCTGCAATCATAGATCAT pLKO.1 4005 CDS 100% 4.950 6.930 N Cdc42bpa n/a
7 TRCN0000360798 CCGAGAGCAGAGCGAACATTA pLKO_005 2294 CDS 100% 13.200 10.560 N Cdc42bpa n/a
8 TRCN0000360799 AGTAAACCCTCACGAATTAAA pLKO_005 5768 3UTR 100% 15.000 10.500 N Cdc42bpa n/a
9 TRCN0000195596 CCAGGCTAGTGAGCGATTAAA pLKO.1 2006 CDS 100% 15.000 10.500 N CDC42BPA n/a
10 TRCN0000022981 GAGAGGGATGTGTTGGTAAAT pLKO.1 723 CDS 100% 13.200 9.240 N LOC381309 n/a
11 TRCN0000022972 GTAGACATCGTAAGGGCATTT pLKO.1 300 5UTR 100% 10.800 7.560 N LOC329302 n/a
12 TRCN0000022983 AGGTTGCTGTAGTTAAACTAA pLKO.1 619 CDS 100% 5.625 3.938 N LOC381309 n/a
13 TRCN0000022682 GCACCTTACATCCCAGAAGTT pLKO.1 1416 CDS 100% 4.950 3.465 N Cdc42bpa n/a
14 TRCN0000022681 GCATCTAACATCTTAACAGAA pLKO.1 3063 CDS 100% 4.950 3.465 N Cdc42bpa n/a
15 TRCN0000000660 GCGATTACATAGAGAAGACTT pLKO.1 560 CDS 100% 4.950 3.465 N CDC42BPA n/a
16 TRCN0000001331 GCGATTACATAGAGAAGACTT pLKO.1 560 CDS 100% 4.950 3.465 N CDC42BPA n/a
17 TRCN0000022982 CCTGAAGAGATGGCTCGGTTT pLKO.1 870 CDS 100% 4.050 2.835 N LOC381309 n/a
18 TRCN0000022683 GCACAGGAAGTTTAAGGAGAT pLKO.1 4358 CDS 100% 4.050 2.835 N Cdc42bpa n/a
19 TRCN0000199935 GCTCGCCATGTCCGAGATAAG pLKO.1 2139 CDS 100% 3.600 2.520 N CDC42BPA n/a
20 TRCN0000196514 GTGGAATTGATTGGGATAATA pLKO.1 1381 CDS 100% 15.000 10.500 N CDC42BPA n/a
21 TRCN0000096439 GCAGCAGGAAAGAGAAGAATT pLKO.1 1970 CDS 100% 0.000 0.000 Y Hivep3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346804.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.