Transcript: Human NM_001346993.2

Homo sapiens zinc finger protein 782 (ZNF782), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ZNF782 (158431)
Length:
4166
CDS:
485..2512

Additional Resources:

NCBI RefSeq record:
NM_001346993.2
NBCI Gene record:
ZNF782 (158431)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001346993.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108181 CCATCATAAGGAGGAAGTTAT pLKO.1 1000 CDS 100% 13.200 9.240 N ZNF782 n/a
2 TRCN0000108183 CGGGAAATCTTTCAGCCATAT pLKO.1 1861 CDS 100% 10.800 7.560 N ZNF782 n/a
3 TRCN0000108182 CGGGAGAGAAACCATACAAAT pLKO.1 1662 CDS 100% 13.200 7.920 N ZNF782 n/a
4 TRCN0000108180 GCTGGAAATCAAACCTCACAA pLKO.1 2547 3UTR 100% 4.950 2.970 N ZNF782 n/a
5 TRCN0000108184 GCGGGAAATCTTTCAGCCATA pLKO.1 1860 CDS 100% 4.050 2.430 N ZNF782 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346993.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09722 pDONR223 100% 96.5% 96.4% None 0_1ins72;1747G>T n/a
2 ccsbBroad304_09722 pLX_304 0% 96.5% 96.4% V5 0_1ins72;1747G>T n/a
3 TRCN0000479347 GTATCCCAATAATCAGCAGGGAGG pLX_317 23.6% 96.5% 96.4% V5 0_1ins72;1747G>T n/a
Download CSV