Transcript: Mouse NM_001347121.1

Mus musculus mitochondrial ribosomal protein S14 (Mrps14), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Mrps14 (64659)
Length:
2132
CDS:
188..556

Additional Resources:

NCBI RefSeq record:
NM_001347121.1
NBCI Gene record:
Mrps14 (64659)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347121.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104435 GCCAGTATAGTTCCTGATTAA pLKO.1 1566 3UTR 100% 13.200 10.560 N Mrps14 n/a
2 TRCN0000104436 CGTGATTTGAAGAGACGGAAA pLKO.1 275 CDS 100% 4.050 2.835 N Mrps14 n/a
3 TRCN0000302535 CGTGATTTGAAGAGACGGAAA pLKO_005 275 CDS 100% 4.050 2.835 N Mrps14 n/a
4 TRCN0000104437 GCTGTCCTGTTAGAATCAGAA pLKO.1 414 CDS 100% 4.950 2.970 N Mrps14 n/a
5 TRCN0000302532 GCTGTCCTGTTAGAATCAGAA pLKO_005 414 CDS 100% 4.950 2.970 N Mrps14 n/a
6 TRCN0000104439 CGCTCAGAAAGAATACCATTT pLKO.1 336 CDS 100% 10.800 5.400 Y Mrps14 n/a
7 TRCN0000302610 CGCTCAGAAAGAATACCATTT pLKO_005 336 CDS 100% 10.800 5.400 Y Mrps14 n/a
8 TRCN0000104438 GTTACTATGTAGACTGGAGAA pLKO.1 249 CDS 100% 4.050 2.025 Y Mrps14 n/a
9 TRCN0000302533 GTTACTATGTAGACTGGAGAA pLKO_005 249 CDS 100% 4.050 2.025 Y Mrps14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347121.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03909 pDONR223 100% 79.8% 76.9% None (many diffs) n/a
2 ccsbBroad304_03909 pLX_304 0% 79.8% 76.9% V5 (many diffs) n/a
3 TRCN0000470637 TGGGAGCCGTAGTCCGCCAAAGGC pLX_317 100% 79.8% 76.9% V5 (many diffs) n/a
Download CSV