Transcript: Mouse NM_001347156.1

Mus musculus kit ligand (Kitl), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Kitl (17311)
Length:
5388
CDS:
201..938

Additional Resources:

NCBI RefSeq record:
NM_001347156.1
NBCI Gene record:
Kitl (17311)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347156.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067871 CTACGAGATATGGTAATACAA pLKO.1 408 CDS 100% 5.625 7.875 N Kitl n/a
2 TRCN0000303182 CTACGAGATATGGTAATACAA pLKO_005 408 CDS 100% 5.625 7.875 N Kitl n/a
3 TRCN0000067869 CCTATTTAATCCTCTTGTCAA pLKO.1 251 CDS 100% 4.950 6.930 N Kitl n/a
4 TRCN0000305053 ATATGATAACCCTCAACTATG pLKO_005 352 CDS 100% 10.800 8.640 N Kitl n/a
5 TRCN0000067870 CGCTTGTAATTGGCTTTGCTT pLKO.1 790 CDS 100% 3.000 2.400 N Kitl n/a
6 TRCN0000311250 CCTGCAGCCTGTCGTTAATTA pLKO_005 1298 3UTR 100% 15.000 10.500 N Kitl n/a
7 TRCN0000067868 CGGCTCTCATTTCGCTTGTAA pLKO.1 778 CDS 100% 5.625 3.938 N Kitl n/a
8 TRCN0000303249 CGGCTCTCATTTCGCTTGTAA pLKO_005 778 CDS 100% 5.625 3.938 N Kitl n/a
9 TRCN0000149952 GTCTTACAAGGGCAGTTGAAA pLKO.1 844 CDS 100% 5.625 3.938 N KITLG n/a
10 TRCN0000067872 GCCTTATACTGGAAGAAGAAA pLKO.1 816 CDS 100% 5.625 3.375 N Kitl n/a
11 TRCN0000303181 GCCTTATACTGGAAGAAGAAA pLKO_005 816 CDS 100% 5.625 3.375 N Kitl n/a
12 TRCN0000059228 GCTTCATAAATGAAGCAGCTT pLKO.1 995 3UTR 100% 0.264 0.185 N KITLG n/a
13 TRCN0000147684 GCTTCATAAATGAAGCAGCTT pLKO.1 995 3UTR 100% 0.264 0.185 N KITLG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347156.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01008 pDONR223 100% 79% 72.1% None (many diffs) n/a
2 ccsbBroad304_01008 pLX_304 0% 79% 72.1% V5 (many diffs) n/a
3 TRCN0000473073 TGACACCGGCCCATAGAATGACCG pLX_317 50% 79% 72.1% V5 (many diffs) n/a
Download CSV