Transcript: Mouse NM_001347209.1

Mus musculus transformer 2 alpha homolog (Drosophila) (Tra2a), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Tra2a (101214)
Length:
1822
CDS:
180..1022

Additional Resources:

NCBI RefSeq record:
NM_001347209.1
NBCI Gene record:
Tra2a (101214)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347209.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348814 ATCTCGGAGTAGGTCCTATAC pLKO_005 416 CDS 100% 10.800 15.120 N Tra2a n/a
2 TRCN0000109136 CCAAACATTCTGAATCCCATT pLKO.1 307 CDS 100% 4.050 5.670 N Tra2a n/a
3 TRCN0000348815 ACACTTGCTTGGGAGTATTTG pLKO_005 526 CDS 100% 13.200 9.240 N Tra2a n/a
4 TRCN0000109139 CCATTCTCGATCAAGATCAAA pLKO.1 323 CDS 100% 5.625 3.938 N Tra2a n/a
5 TRCN0000351905 CCATTCTCGATCAAGATCAAA pLKO_005 323 CDS 100% 5.625 3.938 N Tra2a n/a
6 TRCN0000109137 GCTATGACAGATACGAAGATT pLKO.1 913 CDS 100% 5.625 3.938 N Tra2a n/a
7 TRCN0000351978 GCTATGACAGATACGAAGATT pLKO_005 913 CDS 100% 5.625 3.938 N Tra2a n/a
8 TRCN0000109135 CCACCCTTTGTTATACTCTAA pLKO.1 1166 3UTR 100% 4.950 3.465 N Tra2a n/a
9 TRCN0000109138 CGAGGCTATGACAGATACGAA pLKO.1 909 CDS 100% 3.000 2.100 N Tra2a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347209.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03099 pDONR223 100% 88.3% 97.8% None (many diffs) n/a
2 ccsbBroad304_03099 pLX_304 0% 88.3% 97.8% V5 (many diffs) n/a
3 TRCN0000472178 TGTCGACCGAAGAGTGCGGCATTG pLX_317 7.6% 88.3% 97.8% V5 (many diffs) n/a
Download CSV