Transcript: Mouse NM_001347220.1

Mus musculus NIPA-like domain containing 3 (Nipal3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-04-24
Taxon:
Mus musculus (mouse)
Gene:
Nipal3 (74552)
Length:
1702
CDS:
395..1651

Additional Resources:

NCBI RefSeq record:
NM_001347220.1
NBCI Gene record:
Nipal3 (74552)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347220.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265181 ATTCCGTTCGAGCCCTATATT pLKO_005 1388 CDS 100% 15.000 21.000 N Nipal3 n/a
2 TRCN0000251418 TCGGAGCACTCTTGGCCATTT pLKO_005 510 CDS 100% 10.800 15.120 N Nipal3 n/a
3 TRCN0000251419 GTGAAGCCTCCCAGATCTATG pLKO_005 1188 CDS 100% 10.800 7.560 N Nipal3 n/a
4 TRCN0000201551 CCTACTTCAAGACCAAGACAT pLKO.1 612 CDS 100% 4.950 3.465 N Nipal3 n/a
5 TRCN0000189696 GCTAGTGACATTTGCACCCAA pLKO.1 856 CDS 100% 2.640 1.848 N Nipal3 n/a
6 TRCN0000251421 GCGCCATCATCGGAATCATAT pLKO_005 744 CDS 100% 13.200 7.920 N Nipal3 n/a
7 TRCN0000202307 GAAGATGACAGGCGAGAACAT pLKO.1 886 CDS 100% 4.950 2.970 N Nipal3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347220.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15943 pDONR223 0% 46.8% 45.9% None (many diffs) n/a
2 ccsbBroad304_15943 pLX_304 0% 46.8% 45.9% V5 (many diffs) n/a
3 TRCN0000467451 TCGGCCCATTGCACAGCGAACAAC pLX_317 59.1% 46.8% 45.9% V5 (many diffs) n/a
Download CSV