Transcript: Mouse NM_001347316.1

Mus musculus F-box protein 25 (Fbxo25), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Fbxo25 (66822)
Length:
2122
CDS:
133..1230

Additional Resources:

NCBI RefSeq record:
NM_001347316.1
NBCI Gene record:
Fbxo25 (66822)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347316.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000190791 GCTGATGTATTTCACGCTTCA pLKO.1 1017 CDS 100% 4.050 5.670 N Fbxo25 n/a
2 TRCN0000339807 GCTGATGTATTTCACGCTTCA pLKO_005 1017 CDS 100% 4.050 5.670 N Fbxo25 n/a
3 TRCN0000201508 CACCATCAACCACAGCATTAT pLKO.1 249 CDS 100% 13.200 9.240 N Fbxo25 n/a
4 TRCN0000339806 CACCATCAACCACAGCATTAT pLKO_005 249 CDS 100% 13.200 9.240 N Fbxo25 n/a
5 TRCN0000339873 TCAAACTACTGCAGCTAATTG pLKO_005 506 CDS 100% 13.200 9.240 N Fbxo25 n/a
6 TRCN0000201018 CGACTCCATTTGTACTTCTTT pLKO.1 1436 3UTR 100% 5.625 3.938 N Fbxo25 n/a
7 TRCN0000339872 CGACTCCATTTGTACTTCTTT pLKO_005 1436 3UTR 100% 5.625 3.938 N Fbxo25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347316.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02942 pDONR223 100% 66% 64.8% None (many diffs) n/a
2 ccsbBroad304_02942 pLX_304 0% 66% 64.8% V5 (many diffs) n/a
3 TRCN0000480232 CAAACACCTAAATTATAGCACTTG pLX_317 37.7% 66% 64.8% V5 (many diffs) n/a
Download CSV