Transcript: Mouse NM_001347442.1

Mus musculus 5-hydroxytryptamine (serotonin) receptor 7 (Htr7), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Htr7 (15566)
Length:
3471
CDS:
108..1520

Additional Resources:

NCBI RefSeq record:
NM_001347442.1
NBCI Gene record:
Htr7 (15566)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347442.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009125 GTACCGGAATATCAACCGGAA pLKO.1 1322 CDS 100% 0.000 0.000 N HTR7 n/a
2 TRCN0000027415 CGATGACAAAGTGTGCTTGAT pLKO.1 794 CDS 100% 4.950 3.960 N Htr7 n/a
3 TRCN0000027420 GCTATGCAAACTCTCTCATTA pLKO.1 1234 CDS 100% 13.200 9.240 N Htr7 n/a
4 TRCN0000027443 GCTGTTCATGTACTATCAGAT pLKO.1 881 CDS 100% 4.950 3.465 N Htr7 n/a
5 TRCN0000027427 CCACTTCTTCTGCAACGTCTT pLKO.1 569 CDS 100% 4.050 2.835 N Htr7 n/a
6 TRCN0000027449 GAAAGTTGTGATCGGCTCCAT pLKO.1 356 CDS 100% 2.640 1.584 N Htr7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347442.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00808 pDONR223 100% 85.2% 88.5% None (many diffs) n/a
2 ccsbBroad304_00808 pLX_304 0% 85.2% 88.5% V5 (many diffs) n/a
3 TRCN0000488221 AACAACTTAGTTTTTTTGTTAAGT pLX_317 26.7% 83.9% 88.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV