Transcript: Mouse NM_001347510.1

Mus musculus nucleolar protein 4 (Nol4), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-04-24
Taxon:
Mus musculus (mouse)
Gene:
Nol4 (319211)
Length:
5147
CDS:
1640..3361

Additional Resources:

NCBI RefSeq record:
NM_001347510.1
NBCI Gene record:
Nol4 (319211)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347510.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127175 GCTCAATAGAAAGTGACGAAT pLKO.1 2286 CDS 100% 4.950 3.960 N Nol4 n/a
2 TRCN0000127174 GCCTGGATATTCTTAATTCAA pLKO.1 3631 3UTR 100% 5.625 3.938 N Nol4 n/a
3 TRCN0000146996 CAAAGCAATTTCAGAGAGCTA pLKO.1 2047 CDS 100% 2.640 1.848 N NOL4 n/a
4 TRCN0000127178 CGAGAGTAGAAATGCTGCCAA pLKO.1 2944 CDS 100% 2.640 1.848 N Nol4 n/a
5 TRCN0000127177 CTCAATAGAAAGTGACGAATT pLKO.1 2287 CDS 100% 0.000 0.000 N Nol4 n/a
6 TRCN0000424309 ACCAAGACGGTGACCCGTAAA pLKO_005 1712 CDS 100% 10.800 15.120 N NOL4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347510.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11297 pDONR223 100% 65% 68.2% None (many diffs) n/a
2 ccsbBroad304_11297 pLX_304 0% 65% 68.2% V5 (many diffs) n/a
3 TRCN0000474534 TAATTCATAGTAGGTCAAAAGAAC pLX_317 41.4% 65% 68.2% V5 (many diffs) n/a
Download CSV