Transcript: Mouse NM_001347562.1

Mus musculus toll interacting protein (Tollip), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Tollip (54473)
Length:
3854
CDS:
255..1067

Additional Resources:

NCBI RefSeq record:
NM_001347562.1
NBCI Gene record:
Tollip (54473)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347562.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000066135 CCTCGCTGGAACAAAGTCATT pLKO.1 534 CDS 100% 4.950 3.465 N Tollip n/a
2 TRCN0000302407 CCTCGCTGGAACAAAGTCATT pLKO_005 534 CDS 100% 4.950 3.465 N Tollip n/a
3 TRCN0000066136 CTCCGTATAACACCCACACAA pLKO.1 306 CDS 100% 4.950 3.465 N Tollip n/a
4 TRCN0000066137 CATGACTCGTATGGACCCTTA pLKO.1 449 CDS 100% 4.050 2.835 N Tollip n/a
5 TRCN0000302405 CATGACTCGTATGGACCCTTA pLKO_005 449 CDS 100% 4.050 2.835 N Tollip n/a
6 TRCN0000066134 CCTCAAAGCTATCCAGGACAT pLKO.1 941 CDS 100% 4.050 2.835 N Tollip n/a
7 TRCN0000302406 CCTCAAAGCTATCCAGGACAT pLKO_005 941 CDS 100% 4.050 2.835 N Tollip n/a
8 TRCN0000066133 GCCATCAATTCCTTGCTGCAA pLKO.1 1029 CDS 100% 2.640 1.584 N Tollip n/a
9 TRCN0000302335 GCCATCAATTCCTTGCTGCAA pLKO_005 1029 CDS 100% 2.640 1.584 N Tollip n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347562.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03420 pDONR223 100% 83.7% 89% None (many diffs) n/a
2 ccsbBroad304_03420 pLX_304 0% 83.7% 89% V5 (many diffs) n/a
3 TRCN0000466589 GATTTGCACCTTAGACAGGGGGTC pLX_317 28.7% 83.7% 89% V5 (many diffs) n/a
4 ccsbBroadEn_08382 pDONR223 100% 83.7% 89% None (many diffs) n/a
5 ccsbBroad304_08382 pLX_304 0% 83.7% 89% V5 (many diffs) n/a
6 TRCN0000479669 GATAAACAAGTCATTGATCTGGAA pLX_317 38% 83.7% 89% V5 (many diffs) n/a
Download CSV