Transcript: Human NM_001347953.1

Homo sapiens rabphilin 3A (RPH3A), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
RPH3A (22895)
Length:
4398
CDS:
213..2297

Additional Resources:

NCBI RefSeq record:
NM_001347953.1
NBCI Gene record:
RPH3A (22895)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001347953.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419241 CATCGGCAAGTCCAATGATTA pLKO_005 2141 CDS 100% 13.200 18.480 N RPH3A n/a
2 TRCN0000220581 CCCGAATTCAATGAGGAGTTT pLKO.1 2055 CDS 100% 0.000 0.000 N RPH3A n/a
3 TRCN0000220582 CCCACAGCCTATGCCTATAAA pLKO.1 710 CDS 100% 15.000 10.500 N RPH3A n/a
4 TRCN0000220580 CCTCTCAGTTTGGGTAAATTA pLKO.1 2581 3UTR 100% 15.000 10.500 N RPH3A n/a
5 TRCN0000419452 TTTGGCCACAATGAATTTATT pLKO_005 1674 CDS 100% 15.000 10.500 N RPH3A n/a
6 TRCN0000419397 CCTGCAGTGCACCATCATTAA pLKO_005 1436 CDS 100% 13.200 9.240 N RPH3A n/a
7 TRCN0000435461 GAACCACGTGTCAAGTGATTA pLKO_005 2276 CDS 100% 13.200 9.240 N RPH3A n/a
8 TRCN0000436342 AGCGAGTGATTCCTATGAAAC pLKO_005 1762 CDS 100% 10.800 7.560 N RPH3A n/a
9 TRCN0000220583 GTGTAGTATGTGAGGACTGTA pLKO.1 547 CDS 100% 4.950 3.465 N RPH3A n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2664 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347953.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07812 pDONR223 100% 99.3% 99.2% None 71_82del;1275C>T;1464T>C n/a
2 ccsbBroad304_07812 pLX_304 0% 99.3% 99.2% V5 71_82del;1275C>T;1464T>C n/a
3 TRCN0000477369 CAACTCGTGAATAAGATCATACCT pLX_317 16.1% 99.3% 99.2% V5 71_82del;1275C>T;1464T>C n/a
Download CSV