Transcript: Human NM_001348078.2

Homo sapiens lon peptidase 2, peroxisomal (LONP2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
LONP2 (83752)
Length:
4217
CDS:
90..2810

Additional Resources:

NCBI RefSeq record:
NM_001348078.2
NBCI Gene record:
LONP2 (83752)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348078.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435709 GCAACGTACGACAGGATTTAA pLKO_005 2527 CDS 100% 15.000 21.000 N LONP2 n/a
2 TRCN0000423387 CCAGATTGTACAGGTCTTAAA pLKO_005 413 CDS 100% 13.200 18.480 N LONP2 n/a
3 TRCN0000415696 ATGCCAGAGCAGGCCCATAAA pLKO_005 933 CDS 100% 13.200 9.240 N LONP2 n/a
4 TRCN0000417010 CATAACTTCACAGATCATTAT pLKO_005 1494 CDS 100% 13.200 9.240 N LONP2 n/a
5 TRCN0000046832 CCACTGCTTGTCAGACAAATT pLKO.1 735 CDS 100% 13.200 9.240 N LONP2 n/a
6 TRCN0000046830 CCCACTACACTCTGTTGATTA pLKO.1 376 CDS 100% 13.200 9.240 N LONP2 n/a
7 TRCN0000046829 CCTCAGTCAATGCCAGAATAT pLKO.1 990 CDS 100% 13.200 9.240 N LONP2 n/a
8 TRCN0000046831 GCCAGGAGTAGCAATAGGTTT pLKO.1 2048 CDS 100% 4.950 3.465 N LONP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348078.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09113 pDONR223 100% 93.9% 93.9% None 2548A>T;2556_2718delinsG n/a
2 ccsbBroad304_09113 pLX_304 0% 93.9% 93.9% V5 2548A>T;2556_2718delinsG n/a
3 TRCN0000476793 CATAAACACCTAATGTCAAGTTCT pLX_317 14.1% 93.9% 93.9% V5 2548A>T;2556_2718delinsG n/a
Download CSV