Transcript: Human NM_001348120.1

Homo sapiens tripartite motif containing 16 (TRIM16), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
TRIM16 (10626)
Length:
3110
CDS:
767..2461

Additional Resources:

NCBI RefSeq record:
NM_001348120.1
NBCI Gene record:
TRIM16 (10626)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348120.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222059 CCGCATCAGGTGAACATCAAA pLKO.1 1085 CDS 100% 5.625 3.938 N TRIM16 n/a
2 TRCN0000333849 CCGCATCAGGTGAACATCAAA pLKO_005 1085 CDS 100% 5.625 3.938 N TRIM16 n/a
3 TRCN0000222061 CTGTGTGACTTCTGCCTTGAT pLKO.1 992 CDS 100% 4.950 3.465 N TRIM16 n/a
4 TRCN0000222060 GCCGTTGTTCAGCGCAAATAT pLKO.1 1811 CDS 100% 15.000 9.000 N TRIM16 n/a
5 TRCN0000333770 GCCGTTGTTCAGCGCAAATAT pLKO_005 1811 CDS 100% 15.000 9.000 N TRIM16 n/a
6 TRCN0000146705 CCTGCCTGTTTGTAGTAATTT pLKO.1 2943 3UTR 100% 15.000 7.500 Y TRIM16L n/a
7 TRCN0000222058 CCTGCCTGTTTGTAGTAATTT pLKO.1 2943 3UTR 100% 15.000 7.500 Y TRIM16 n/a
8 TRCN0000333852 CCTGCCTGTTTGTAGTAATTT pLKO_005 2943 3UTR 100% 15.000 7.500 Y TRIM16 n/a
9 TRCN0000222062 GCCAATGTGATGCTCTTCTTA pLKO.1 1457 CDS 100% 5.625 2.813 Y TRIM16 n/a
10 TRCN0000333769 GCCAATGTGATGCTCTTCTTA pLKO_005 1457 CDS 100% 5.625 2.813 Y TRIM16 n/a
11 TRCN0000149914 GATGCTCTTCTTAGAGGAGAA pLKO.1 1465 CDS 100% 4.050 2.025 Y TRIM16L n/a
12 TRCN0000149079 GCGCAAATATTGGACTTCCAA pLKO.1 1822 CDS 100% 3.000 1.500 Y TRIM16L n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2906 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2906 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348120.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07656 pDONR223 100% 99.9% 99.8% None 1682G>T n/a
2 ccsbBroad304_07656 pLX_304 0% 99.9% 99.8% V5 1682G>T n/a
3 TRCN0000471452 CCTTCCGTGGACGAAAAGTAGCCG pLX_317 27.2% 99.9% 99.8% V5 1682G>T n/a
4 ccsbBroadEn_09642 pDONR223 100% 60.8% 59.9% None (many diffs) n/a
5 TRCN0000476581 AATAGGTTAAACCGGCTGCTGCGC pLX_317 34.9% 60.8% 59.9% V5 (many diffs) n/a
Download CSV