Transcript: Human NM_001348185.2

Homo sapiens intersectin 2 (ITSN2), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
ITSN2 (50618)
Length:
7078
CDS:
267..3806

Additional Resources:

NCBI RefSeq record:
NM_001348185.2
NBCI Gene record:
ITSN2 (50618)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348185.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381122 AGCGCAGTCTCTGATTGATTT pLKO_005 887 CDS 100% 13.200 18.480 N ITSN2 n/a
2 TRCN0000002385 CCTGGACTGCAAAGAAAGATA pLKO.1 2950 CDS 100% 5.625 3.938 N ITSN2 n/a
3 TRCN0000318479 CCTGGACTGCAAAGAAAGATA pLKO_005 2950 CDS 100% 5.625 3.938 N ITSN2 n/a
4 TRCN0000002382 GCAGAACGTAAAGCCCAGAAA pLKO.1 1443 CDS 100% 4.950 3.465 N ITSN2 n/a
5 TRCN0000318540 GCAGAACGTAAAGCCCAGAAA pLKO_005 1443 CDS 100% 4.950 3.465 N ITSN2 n/a
6 TRCN0000002381 GTCGCTTAGAATGGGAGAGAA pLKO.1 1639 CDS 100% 4.950 3.465 N ITSN2 n/a
7 TRCN0000318478 GTCGCTTAGAATGGGAGAGAA pLKO_005 1639 CDS 100% 4.950 3.465 N ITSN2 n/a
8 TRCN0000153184 GTGGGAGTTCAAACACACAAA pLKO.1 4124 3UTR 100% 4.950 2.475 Y GOLGA8F n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348185.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10457 pDONR223 100% 67.8% 67.8% None (many diffs) n/a
2 ccsbBroad304_10457 pLX_304 0% 67.8% 67.8% V5 (many diffs) n/a
3 TRCN0000481239 TCCCATTTCGAGTAAGGGAGCATT pLX_317 7.4% 67.8% 67.8% V5 (many diffs) n/a
Download CSV