Transcript: Mouse NM_001348222.1

Mus musculus pyrroline-5-carboxylate reductase 1 (Pycr1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Pycr1 (209027)
Length:
1892
CDS:
153..1082

Additional Resources:

NCBI RefSeq record:
NM_001348222.1
NBCI Gene record:
Pycr1 (209027)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001348222.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042166 TCACTGTGTATGCCACAGGTA pLKO.1 547 CDS 100% 0.264 0.370 N Pycr1 n/a
2 TRCN0000294654 CCCAAAGTCATCCGATGTATG pLKO_005 495 CDS 100% 10.800 8.640 N Pycr1 n/a
3 TRCN0000042163 GCTCTCAAACAACACCGAATA pLKO.1 1463 3UTR 100% 10.800 8.640 N Pycr1 n/a
4 TRCN0000294653 TCTGGCTGCACACAAGATAAT pLKO_005 224 CDS 100% 13.200 9.240 N Pycr1 n/a
5 TRCN0000294655 GGCTTTCGCTCCTTGCTTATC pLKO_005 897 CDS 100% 10.800 7.560 N Pycr1 n/a
6 TRCN0000379194 CATTGAGGACAGGCACATTGT pLKO_005 407 CDS 100% 4.950 3.465 N Pycr1 n/a
7 TRCN0000042164 GCTGCCATAAAGAAGACTGTA pLKO.1 990 CDS 100% 4.950 3.465 N Pycr1 n/a
8 TRCN0000042167 GCCAAGATGCTACTAGACTCA pLKO.1 792 CDS 100% 2.640 1.848 N Pycr1 n/a
9 TRCN0000287146 GCCAAGATGCTACTAGACTCA pLKO_005 792 CDS 100% 2.640 1.848 N Pycr1 n/a
10 TRCN0000042165 GTCACCATCAACTCCATCGAA pLKO.1 447 CDS 100% 3.000 1.800 N Pycr1 n/a
11 TRCN0000351413 GTCACCATCAACTCCATCGAA pLKO_005 447 CDS 100% 3.000 1.800 N Pycr1 n/a
12 TRCN0000038980 CCCTTCATCCTGGATGAAATA pLKO.1 378 CDS 100% 1.320 0.792 N PYCR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348222.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06828 pDONR223 100% 83.7% 88.7% None (many diffs) n/a
2 ccsbBroad304_06828 pLX_304 0% 83.7% 88.7% V5 (many diffs) n/a
3 TRCN0000469386 GACCCGACGTAATGTCCATTCTTG pLX_317 34.8% 83.7% 88.7% V5 (many diffs) n/a
4 ccsbBroadEn_15557 pDONR223 0% 44.1% 45.4% None (many diffs) n/a
5 ccsbBroad304_15557 pLX_304 0% 44.1% 45.4% V5 (many diffs) n/a
6 TRCN0000469155 AATCCCCCGACCGCGGCCGTCCAG pLX_317 63.7% 44.1% 45.4% V5 (many diffs) n/a
Download CSV