Transcript: Human NM_001348355.2

Homo sapiens myosin IF (MYO1F), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
MYO1F (4542)
Length:
4168
CDS:
134..3418

Additional Resources:

NCBI RefSeq record:
NM_001348355.2
NBCI Gene record:
MYO1F (4542)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348355.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158118 CGTCTTCAAGACCGAGTTTGT pLKO.1 2656 CDS 100% 4.950 6.930 N MYO1F n/a
2 TRCN0000156700 CACACTACAGTTTCGGGTGAA pLKO.1 2740 CDS 100% 4.050 5.670 N MYO1F n/a
3 TRCN0000157058 GAGCGAAAGTTCGATGGCTTT pLKO.1 2189 CDS 100% 4.050 5.670 N MYO1F n/a
4 TRCN0000157086 GCCAAATTCCTGCAGAGGTAT pLKO.1 2003 CDS 100% 4.950 6.435 N MYO1F n/a
5 TRCN0000156457 CCAGGTGTGTGAAGTCTTGAA pLKO.1 2533 CDS 100% 4.950 3.960 N MYO1F n/a
6 TRCN0000152449 CAACAGCATCAATCGGAACTT pLKO.1 2317 CDS 100% 4.950 3.465 N MYO1F n/a
7 TRCN0000156636 GCTCTGTGCTCATCTCTGTAA pLKO.1 285 CDS 100% 4.950 3.465 N MYO1F n/a
8 TRCN0000156838 GTGGATGACATGGTGCTTCTT pLKO.1 188 CDS 100% 4.950 3.465 N MYO1F n/a
9 TRCN0000150712 CCATGTGATTAAGAAATGGGT pLKO.1 3697 3UTR 100% 0.750 0.525 N MYO1F n/a
10 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 4041 3UTR 100% 4.950 2.475 Y ERAP2 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4042 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348355.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01048 pDONR223 100% 99.6% 99.6% None 770_771insGAGTGCTATGCA n/a
2 ccsbBroad304_01048 pLX_304 0% 99.6% 99.6% V5 770_771insGAGTGCTATGCA n/a
3 TRCN0000468331 TCTTCATGACGGATTGAACCCCCT pLX_317 12.8% 99.6% 99.6% V5 770_771insGAGTGCTATGCA n/a
Download CSV