Transcript: Human NM_001348364.2

Homo sapiens sialic acid binding Ig like lectin 16 (gene/pseudogene) (SIGLEC16), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
SIGLEC16 (400709)
Length:
3811
CDS:
39..1484

Additional Resources:

NCBI RefSeq record:
NM_001348364.2
NBCI Gene record:
SIGLEC16 (400709)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348364.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157078 GTGACGGTCATCTGTGTGTTT pLKO.1 519 CDS 100% 4.950 2.475 Y SIGLEC10 n/a
2 TRCN0000158034 CTGAGAGTGATGGTTTCCCAA pLKO.1 1026 CDS 100% 2.640 1.320 Y SIGLEC10 n/a
3 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2593 3UTR 100% 13.200 6.600 Y LIAS n/a
4 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 1927 3UTR 100% 4.950 2.475 Y n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348364.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09273 pDONR223 100% 59% 50.4% None (many diffs) n/a
2 ccsbBroad304_09273 pLX_304 0% 59% 50.4% V5 (many diffs) n/a
3 TRCN0000481318 CTTGAACAGTGTGCCTTCGGTTGG pLX_317 19.4% 59% 50.4% V5 (many diffs) n/a
Download CSV