Transcript: Human NM_001348651.2

Homo sapiens ankyrin repeat domain 9 (ANKRD9), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
ANKRD9 (122416)
Length:
6711
CDS:
589..1542

Additional Resources:

NCBI RefSeq record:
NM_001348651.2
NBCI Gene record:
ANKRD9 (122416)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348651.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242905 CAAGTCGTCGTTCGCCTTCTA pLKO_005 681 CDS 100% 4.950 6.930 N ANKRD9 n/a
2 TRCN0000242906 CACCAAGCGTACGCGCATTAC pLKO_005 838 CDS 100% 3.600 5.040 N ANKRD9 n/a
3 TRCN0000242908 TGGGTGAGGACAAGTTCCAGT pLKO_005 1373 CDS 100% 2.640 1.848 N ANKRD9 n/a
4 TRCN0000242907 CATTACCTGCTGGCCACGTTC pLKO_005 853 CDS 100% 1.350 0.945 N ANKRD9 n/a
5 TRCN0000242904 CGTGTGGCTGCTGGAGGATAT pLKO_005 726 CDS 100% 3.600 2.160 N ANKRD9 n/a
6 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 4916 3UTR 100% 4.950 2.475 Y CFLAR n/a
7 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 4916 3UTR 100% 4.950 2.475 Y C19orf31 n/a
8 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 5080 3UTR 100% 10.800 5.400 Y SMIM11A n/a
9 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 4914 3UTR 100% 4.950 2.475 Y ERN2 n/a
10 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 4914 3UTR 100% 4.950 2.475 Y P3H4 n/a
11 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 4914 3UTR 100% 4.950 2.475 Y P3H4 n/a
12 TRCN0000139610 CGAACTCCTGACCTTGTGATA pLKO.1 5467 3UTR 100% 4.950 2.475 Y RBM48 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348651.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.