Transcript: Human NM_001348944.1

Homo sapiens ATP binding cassette subfamily B member 1 (ABCB1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
ABCB1 (5243)
Length:
4569
CDS:
347..4189

Additional Resources:

NCBI RefSeq record:
NM_001348944.1
NBCI Gene record:
ABCB1 (5243)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348944.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059685 CGACAGAATAGTAACTTGTTT pLKO.1 2591 CDS 100% 5.625 7.875 N ABCB1 n/a
2 TRCN0000059684 GCAGCAATTAGAACTGTGATT pLKO.1 1121 CDS 100% 4.950 3.960 N ABCB1 n/a
3 TRCN0000059683 CCGAACACATTGGAAGGAAAT pLKO.1 3428 CDS 100% 10.800 7.560 N ABCB1 n/a
4 TRCN0000059686 GCTCATCGTTTGTCTACAGTT pLKO.1 2102 CDS 100% 4.950 3.465 N ABCB1 n/a
5 TRCN0000059687 GCTGCTTTCCTGCTGATCTAT pLKO.1 1247 CDS 100% 5.625 3.375 N ABCB1 n/a
6 TRCN0000177593 CAGCAGGAAATGAAGTTGAAA pLKO.1 2235 CDS 100% 5.625 3.938 N Ubxn8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348944.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488873 GGAGCCTAGACGATTTGACCACTA pLX_317 8.5% 99.9% 99.9% V5 3840_3841insG n/a
Download CSV