Transcript: Human NM_001349180.2

Homo sapiens xylulokinase (XYLB), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
XYLB (9942)
Length:
1641
CDS:
85..285

Additional Resources:

NCBI RefSeq record:
NM_001349180.2
NBCI Gene record:
XYLB (9942)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001349180.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037930 GCAGAGTTGAATGTCTTCTAT pLKO.1 163 CDS 100% 5.625 3.938 N XYLB n/a
2 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 471 3UTR 100% 4.950 2.475 Y ERAP2 n/a
3 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 472 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001349180.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14948 pDONR223 0% 12.8% 11.2% None (many diffs) n/a
2 ccsbBroad304_14948 pLX_304 0% 12.8% 11.2% V5 (many diffs) n/a
3 TRCN0000471651 GACTCCCGATTGTTCTTCAGTTCC pLX_317 31% 12.8% 11.2% V5 (many diffs) n/a
Download CSV