Transcript: Human NM_001349476.1

Homo sapiens chromosome 8 open reading frame 34 (C8orf34), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-12-05
Taxon:
Homo sapiens (human)
Gene:
C8orf34 (116328)
Length:
3041
CDS:
641..2248

Additional Resources:

NCBI RefSeq record:
NM_001349476.1
NBCI Gene record:
C8orf34 (116328)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001349476.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421435 TGATAAACCTTGGCAATTAAA pLKO_005 1150 CDS 100% 15.000 21.000 N C8orf34 n/a
2 TRCN0000417275 GAATTGCTGGAGGATCTTAAT pLKO_005 1736 CDS 100% 13.200 18.480 N C8orf34 n/a
3 TRCN0000283348 TAAACCACAAAGCCGTGATTT pLKO_005 1288 CDS 100% 13.200 10.560 N A830018L16Rik n/a
4 TRCN0000147468 CAAAGGAACAAGAAGGGATTT pLKO.1 1120 CDS 100% 10.800 7.560 N C8orf34 n/a
5 TRCN0000432798 GAAGTTGCAAGTGGTCCTTAA pLKO_005 2260 3UTR 100% 10.800 7.560 N C8orf34 n/a
6 TRCN0000148404 CCACTGCTCTTTCTCATGATT pLKO.1 2771 3UTR 100% 5.625 3.938 N C8orf34 n/a
7 TRCN0000130578 CTAAACCACAAAGCCGTGATT pLKO.1 1287 CDS 100% 4.950 3.465 N C8orf34 n/a
8 TRCN0000148947 CCCATTTCTCATTGACCATCT pLKO.1 1012 CDS 100% 4.050 2.835 N C8orf34 n/a
9 TRCN0000127702 GAGAACACTAATCCTGGCAAA pLKO.1 2419 3UTR 100% 4.050 2.835 N C8orf34 n/a
10 TRCN0000148600 CCCAGATTCATTCGATTCCTT pLKO.1 1945 CDS 100% 3.000 2.100 N C8orf34 n/a
11 TRCN0000149039 GCTGATCTTCTTCTTTGCGTT pLKO.1 2186 CDS 100% 2.640 1.848 N C8orf34 n/a
12 TRCN0000129775 CCATTTCTCATTGACCATCTT pLKO.1 1013 CDS 100% 4.950 2.970 N C8orf34 n/a
13 TRCN0000345844 GAGAATCTCTCTCGAAGTATC pLKO_005 1361 CDS 100% 10.800 15.120 N A830018L16Rik n/a
14 TRCN0000256054 AGCCAACAAGCACCAGATTAA pLKO_005 251 5UTR 100% 13.200 6.600 Y RPL23AP42 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001349476.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13059 pDONR223 100% 80.1% 76.4% None (many diffs) n/a
2 ccsbBroad304_13059 pLX_304 0% 80.1% 76.4% V5 (many diffs) n/a
3 TRCN0000476227 CCTAAGGTCATGCATCTGCGGTTA pLX_317 29.8% 80.1% 76.4% V5 (many diffs) n/a
Download CSV