Transcript: Human NM_001349503.1

Homo sapiens PX domain containing serine/threonine kinase like (PXK), transcript variant 23, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
PXK (54899)
Length:
3067
CDS:
100..1644

Additional Resources:

NCBI RefSeq record:
NM_001349503.1
NBCI Gene record:
PXK (54899)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145501 GGAACGGCTAGTGTTAAGCT pXPR_003 GGG 535 35% 6 0.8637 PXK PXK 78017
2 BRDN0001146866 TTATGGACGACCGCCAGACT pXPR_003 CGG 1054 68% 11 0.632 PXK PXK 78018
3 BRDN0001487114 TCTTCCGATCAGAACCAAAG pXPR_003 TGG 432 28% 5 0.1005 PXK PXK 78019
4 BRDN0001147508 CTCCAATGTGATGCTCGATG pXPR_003 GGG 889 58% 10 -0.1763 PXK PXK 78020
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001349503.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001804 TCCGCAAACTATACTGAGATT pLKO.1 472 CDS 100% 4.950 6.930 N PXK n/a
2 TRCN0000001803 CCACAGTTTAAGATCCCTACA pLKO.1 1318 CDS 100% 4.050 5.670 N PXK n/a
3 TRCN0000342399 CCACAGTTTAAGATCCCTACA pLKO_005 1318 CDS 100% 4.050 5.670 N PXK n/a
4 TRCN0000195150 CGGAATATATTATTCGAGTGC pLKO.1 200 CDS 100% 2.160 3.024 N PXK n/a
5 TRCN0000001801 GTCTAATCAAACTTCTGCCTT pLKO.1 686 CDS 100% 2.640 2.112 N PXK n/a
6 TRCN0000342361 GTCTAATCAAACTTCTGCCTT pLKO_005 686 CDS 100% 2.640 2.112 N PXK n/a
7 TRCN0000001802 ACAGCCACAAACAGTACTATT pLKO.1 2001 3UTR 100% 13.200 9.240 N PXK n/a
8 TRCN0000194925 CGTTGCTAATTAGGATGTTTA pLKO.1 764 CDS 100% 13.200 9.240 N PXK n/a
9 TRCN0000196594 GTACAGCAACTCCAATAATTC pLKO.1 1542 CDS 100% 13.200 9.240 N PXK n/a
10 TRCN0000195613 CGGCTCTTACAGATGCCATTA pLKO.1 1264 CDS 100% 10.800 7.560 N PXK n/a
11 TRCN0000001800 GCCTTCCTTCTACCGATCTTA pLKO.1 1038 CDS 100% 5.625 3.938 N PXK n/a
12 TRCN0000342398 GCCTTCCTTCTACCGATCTTA pLKO_005 1038 CDS 100% 5.625 3.938 N PXK n/a
13 TRCN0000197047 GCTTCCTGTTTACACTTGGAG pLKO.1 1902 3UTR 100% 2.640 1.848 N PXK n/a
14 TRCN0000199401 CAAACTACCCTCTTCCTGGGA pLKO.1 1961 3UTR 100% 0.660 0.462 N PXK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001349503.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12106 pDONR223 100% 87.4% 87.5% None 903C>T;1351_1542del n/a
2 ccsbBroad304_12106 pLX_304 0% 87.4% 87.5% V5 903C>T;1351_1542del n/a
3 TRCN0000471464 CGATAACATCTCGACTATGCAATA pLX_317 35.6% 87.4% 87.5% V5 903C>T;1351_1542del n/a
4 ccsbBroadEn_15084 pDONR223 0% 87.4% 87.5% None 903C>T;1351_1542del n/a
5 ccsbBroad304_15084 pLX_304 0% 87.4% 87.5% V5 903C>T;1351_1542del n/a
6 TRCN0000465367 CCCCCTCCTCTAAACAATTGGTAC pLX_317 14.5% 87.4% 87.5% V5 903C>T;1351_1542del n/a
Download CSV