Transcript: Human NM_001349768.2

Homo sapiens pre-mRNA processing factor 38B (PRPF38B), transcript variant 12, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
PRPF38B (55119)
Length:
4902
CDS:
945..1994

Additional Resources:

NCBI RefSeq record:
NM_001349768.2
NBCI Gene record:
PRPF38B (55119)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001349768.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294732 TGTCGTCGCCTTACTTCAAAG pLKO_005 482 5UTR 100% 10.800 15.120 N Prpf38b n/a
2 TRCN0000294676 GATCACATTGAATCCTATAAA pLKO_005 2013 3UTR 100% 15.000 12.000 N Prpf38b n/a
3 TRCN0000074335 GCGCTTGGATTTATGTATATA pLKO.1 757 5UTR 100% 15.000 12.000 N PRPF38B n/a
4 TRCN0000074333 GCACAGATTGTTCTTGCATTT pLKO.1 2202 3UTR 100% 10.800 7.560 N PRPF38B n/a
5 TRCN0000074337 GATCGTGACTATGATAAGGAA pLKO.1 1452 CDS 100% 3.000 2.100 N PRPF38B n/a
6 TRCN0000074336 GCGATCAAGAGAAAGGTCCAA pLKO.1 1502 CDS 100% 2.640 1.848 N PRPF38B n/a
7 TRCN0000074334 CGAAAGCAAGTGATGGGTCTT pLKO.1 706 5UTR 100% 4.050 2.430 N PRPF38B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001349768.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.