Transcript: Human NM_001349848.2

Homo sapiens DNA topoisomerase III beta (TOP3B), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-08-11
Taxon:
Homo sapiens (human)
Gene:
TOP3B (8940)
Length:
2916
CDS:
647..2827

Additional Resources:

NCBI RefSeq record:
NM_001349848.2
NBCI Gene record:
TOP3B (8940)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001349848.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049315 CCGAGACATGAAGAAAGGCAT pLKO.1 2329 CDS 100% 2.640 3.696 N TOP3B n/a
2 TRCN0000049314 CCCTGTGCATATCAACAACAT pLKO.1 1780 CDS 100% 4.950 3.960 N TOP3B n/a
3 TRCN0000049317 CCAGGTTTCAGACTAAATATT pLKO.1 816 CDS 100% 15.000 10.500 N TOP3B n/a
4 TRCN0000437420 ACACGGTGAAGCGGTTGTTAG pLKO_005 1332 CDS 100% 10.800 7.560 N TOP3B n/a
5 TRCN0000436295 ACTACTTTGTCGACTCCATTG pLKO_005 2019 CDS 100% 6.000 4.200 N TOP3B n/a
6 TRCN0000049316 GCCAAGGTTAACACTGACAAA pLKO.1 971 CDS 100% 4.950 3.465 N TOP3B n/a
7 TRCN0000049313 CCCTGAGAACTTTGACCTGAA pLKO.1 1270 CDS 100% 4.050 2.835 N TOP3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001349848.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07331 pDONR223 100% 84.1% 84.1% None 0_1ins408;552C>T;685G>A n/a
2 ccsbBroad304_07331 pLX_304 0% 84.1% 84.1% V5 0_1ins408;552C>T;685G>A n/a
3 TRCN0000470171 GCGTCGTGGCATAACCTCCCTACT pLX_317 17.6% 84.1% 83.8% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV