Transcript: Human NM_001349870.2

Homo sapiens transcription factor 7 like 2 (TCF7L2), transcript variant 14, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
TCF7L2 (6934)
Length:
3756
CDS:
595..1614

Additional Resources:

NCBI RefSeq record:
NM_001349870.2
NBCI Gene record:
TCF7L2 (6934)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001349870.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262843 TAGCTGAGTGCACGTTGAAAG pLKO_005 1271 CDS 100% 10.800 15.120 N TCF7L2 n/a
2 TRCN0000282444 CTCCGCACCCTCCAGATATAT pLKO_005 863 CDS 100% 15.000 10.500 N TCF7L2 n/a
3 TRCN0000262848 AGAGAAGAGCAAGCGAAATAC pLKO_005 1342 CDS 100% 13.200 9.240 N TCF7L2 n/a
4 TRCN0000061895 CGTCACCAAGTCTTTAGAATA pLKO.1 2029 3UTR 100% 13.200 9.240 N TCF7L2 n/a
5 TRCN0000262846 TATCGAGTTCATTGGTCAATA pLKO_005 2186 3UTR 100% 13.200 9.240 N TCF7L2 n/a
6 TRCN0000262847 CCTTTCACTTCCTCCGATTAC pLKO_005 1512 CDS 100% 10.800 7.560 N TCF7L2 n/a
7 TRCN0000262849 GTCGACTTCTTCCTTACATTC pLKO_005 1966 3UTR 100% 10.800 7.560 N TCF7L2 n/a
8 TRCN0000061893 GCGGGATAACTATGGAAAGAA pLKO.1 1422 CDS 100% 5.625 3.938 N TCF7L2 n/a
9 TRCN0000061897 CCCACATAAAGAAACCTCTTA pLKO.1 1208 CDS 100% 4.950 3.465 N TCF7L2 n/a
10 TRCN0000174115 CCCACATAAAGAAACCTCTTA pLKO.1 1208 CDS 100% 4.950 3.465 N TCF7L2 n/a
11 TRCN0000012181 GTTTCCTAAATCCTTGCCTTT pLKO.1 1496 CDS 100% 4.050 2.835 N Tcf7l2 n/a
12 TRCN0000061896 GCCTCTTATCACGTACAGCAA pLKO.1 768 CDS 100% 2.640 1.848 N TCF7L2 n/a
13 TRCN0000262851 CCATGTGGCTACATTAGTTGA pLKO_005 2161 3UTR 100% 4.950 2.970 N TCF7L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001349870.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000480255 GCCTCGCGGCGTGACGATTTCTTC pLX_317 23% 66.1% 58.4% V5 (many diffs) n/a
2 ccsbBroadEn_01651 pDONR223 100% 65.4% 58.4% None (many diffs) n/a
3 ccsbBroad304_01651 pLX_304 49.6% 65.4% 58.4% V5 (many diffs) n/a
Download CSV