Construct: ORF TRCN0000480255
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001294.1_s317c1
- Derived from:
- ccsbBroadEn_01651
- DNA Barcode:
- GCCTCGCGGCGTGACGATTTCTTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TCF7L2 (6934)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480255
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6934 | TCF7L2 | transcription factor 7 like 2 | NM_001146284.2 | 99.9% | 100% | 1344C>T |
| 2 | human | 6934 | TCF7L2 | transcription factor 7 like 2 | NM_001198529.2 | 99% | 99.1% | 708_719del;1356C>T |
| 3 | human | 6934 | TCF7L2 | transcription factor 7 like 2 | NM_001198527.2 | 95.8% | 92.1% | (many diffs) |
| 4 | human | 6934 | TCF7L2 | transcription factor 7 like 2 | NM_001146286.2 | 95.3% | 95.4% | 708_719del;1248_1249ins51;1305C>T |
| 5 | human | 6934 | TCF7L2 | transcription factor 7 like 2 | NM_001198528.2 | 94.9% | 91.3% | (many diffs) |
| 6 | human | 6934 | TCF7L2 | transcription factor 7 like 2 | NM_001363501.1 | 94.3% | 94.3% | 382_450del;777_788del;1425C>T |
| 7 | human | 6934 | TCF7L2 | transcription factor 7 like 2 | NM_001198525.2 | 92.5% | 88.1% | (many diffs) |
| 8 | human | 6934 | TCF7L2 | transcription factor 7 like 2 | NM_001198531.2 | 90.8% | 90.8% | (many diffs) |
| 9 | human | 6934 | TCF7L2 | transcription factor 7 like 2 | NM_001198530.1 | 87.9% | 88% | (many diffs) |
| 10 | human | 6934 | TCF7L2 | transcription factor 7 like 2 | NM_001146283.2 | 86.4% | 86.5% | (many diffs) |
| 11 | human | 6934 | TCF7L2 | transcription factor 7 like 2 | NM_001146285.1 | 77.2% | 71.3% | (many diffs) |
| 12 | human | 6934 | TCF7L2 | transcription factor 7 like 2 | NM_001198526.2 | 77.1% | 71.2% | (many diffs) |
| 13 | human | 6934 | TCF7L2 | transcription factor 7 like 2 | NM_030756.5 | 76.2% | 70.8% | (many diffs) |
| 14 | human | 6934 | TCF7L2 | transcription factor 7 like 2 | NM_001146274.2 | 74.2% | 68.5% | (many diffs) |
| 15 | human | 6934 | TCF7L2 | transcription factor 7 like 2 | NM_001367943.1 | 73.4% | 68.2% | (many diffs) |
| 16 | human | 6934 | TCF7L2 | transcription factor 7 like 2 | NM_001349870.2 | 66.1% | 58.4% | (many diffs) |
| 17 | human | 6934 | TCF7L2 | transcription factor 7 like 2 | NM_001349871.1 | 60.5% | 57.3% | (many diffs) |
| 18 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | NM_001331143.1 | 91.9% | 99.5% | (many diffs) |
| 19 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | NM_009333.4 | 91.1% | 98.6% | (many diffs) |
| 20 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | XM_006526888.3 | 90.1% | 97.6% | (many diffs) |
| 21 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | NM_001331142.1 | 87.9% | 91.7% | (many diffs) |
| 22 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | NM_001142923.2 | 87.5% | 94.9% | (many diffs) |
| 23 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | NM_001331135.1 | 87.5% | 94.7% | (many diffs) |
| 24 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | NM_001142918.2 | 87.1% | 90.9% | (many diffs) |
| 25 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | XM_017318127.1 | 87% | 90.7% | (many diffs) |
| 26 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | NM_001331149.1 | 86.7% | 93.9% | (many diffs) |
| 27 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | XM_017318123.1 | 86.7% | 89.4% | (many diffs) |
| 28 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | NM_001142921.2 | 86.6% | 93.9% | (many diffs) |
| 29 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | NM_001331145.1 | 86.3% | 88.6% | (many diffs) |
| 30 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | NM_001331136.1 | 86.2% | 89.9% | (many diffs) |
| 31 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | NM_001331137.1 | 85.9% | 88.6% | (many diffs) |
| 32 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | XM_017318117.1 | 85.9% | 93% | (many diffs) |
| 33 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | NM_001142919.2 | 85.5% | 87.9% | (many diffs) |
| 34 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | XM_017318121.1 | 85% | 87.7% | (many diffs) |
| 35 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | NM_001331144.1 | 84.8% | 88.1% | (many diffs) |
| 36 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | XM_017318131.1 | 84.6% | 87% | (many diffs) |
| 37 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | XM_017318129.1 | 84.1% | 87.3% | (many diffs) |
| 38 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | XM_017318119.1 | 83.7% | 87.4% | (many diffs) |
| 39 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | NM_001331148.1 | 83% | 86.7% | (many diffs) |
| 40 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | XM_017318115.1 | 82.6% | 85.3% | (many diffs) |
| 41 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | XM_017318116.1 | 82.2% | 85.8% | (many diffs) |
| 42 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | XM_017318126.1 | 82.1% | 84.5% | (many diffs) |
| 43 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | XM_017318114.1 | 82% | 84.6% | (many diffs) |
| 44 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | NM_001331150.1 | 81.5% | 83.8% | (many diffs) |
| 45 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | NM_001142920.2 | 77.2% | 82.4% | (many diffs) |
| 46 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | NM_001331141.1 | 71.2% | 71.2% | (many diffs) |
| 47 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | NM_001331139.1 | 70.7% | 70.7% | (many diffs) |
| 48 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | NM_001331140.1 | 70.4% | 70.7% | (many diffs) |
| 49 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | NM_001142922.2 | 69.9% | 70.3% | (many diffs) |
| 50 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | XM_017318112.1 | 69.8% | 70.1% | (many diffs) |
| 51 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | XM_006526866.3 | 69.3% | 69.7% | (many diffs) |
| 52 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | NM_001331147.1 | 68% | 68.1% | (many diffs) |
| 53 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | NM_001331138.1 | 67.8% | 68.1% | (many diffs) |
| 54 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | XM_017318110.1 | 67.5% | 67.5% | (many diffs) |
| 55 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | NM_001331146.1 | 67.3% | 67.7% | (many diffs) |
| 56 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | XM_006526861.3 | 67.2% | 67.6% | (many diffs) |
| 57 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | XM_006526860.3 | 66.8% | 67.2% | (many diffs) |
| 58 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | XM_017318135.1 | 55.3% | 57.8% | (many diffs) |
| 59 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | NM_001142924.2 | 54.8% | 57.3% | (many diffs) |
| 60 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | XM_006526897.3 | 44.7% | 44.3% | (many diffs) |
| 61 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | XM_017318132.1 | 44.7% | 44.3% | (many diffs) |
| 62 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | XM_006526894.3 | 44.3% | 44% | (many diffs) |
| 63 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | XM_006526895.3 | 44.3% | 44% | (many diffs) |
| 64 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | XR_001782573.1 | 32.9% | (many diffs) | |
| 65 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | XR_001782572.1 | 32.7% | (many diffs) | |
| 66 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | XR_001782576.1 | 29.7% | (many diffs) | |
| 67 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | NR_138565.1 | 29.7% | (many diffs) | |
| 68 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | XM_017318134.1 | 29.6% | 27.9% | (many diffs) |
| 69 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | XR_386455.3 | 29.3% | (many diffs) | |
| 70 | mouse | 21416 | Tcf7l2 | transcription factor 7 like... | XR_001782574.1 | 29.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1431
- ORF length:
- 1365
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc gcagctgaac ggcggtggag gggatgacct aggcgccaac gacgaactga 121 tttccttcaa agacgagggc gaacaggagg agaagagctc cgaaaactcc tcggcagaga 181 gggatttagc tgatgtcaaa tcgtctctag tcaatgaatc agaaacgaat caaaacagct 241 cctccgattc cgaggcggaa agacggcctc cgcctcgctc cgaaagtttc cgagacaaat 301 cccgggaaag tttggaagaa gcggccaaga ggcaagatgg agggctcttt aaggggccac 361 cgtatcccgg ctaccccttc atcatgatcc ccgacctgac gagcccctac ctccccaacg 421 gatcgctctc gcccaccgcc cgaacctatc tccagatgaa atggccactg cttgatgtcc 481 aggcagggag cctccagagt agacaagccc tcaaggatgc ccggtcccca tcaccggcac 541 acattgtctc taacaaagtg ccagtggtgc agcaccctca ccatgtccac cccctcacgc 601 ctcttatcac gtacagcaat gaacacttca cgccgggaaa cccacctcca cacttaccag 661 ccgacgtaga ccccaaaaca ggaatcccac ggcctccgca ccctccagat atatccccgt 721 attacccact atcgcctggc accgtaggac aaatccccca tccgctagga tggcaaggtc 781 aaccagtgta cccaatcacg acaggaggat tcagacaccc ctaccccaca gctctgaccg 841 tcaatgcttc catgtccagg ttccctcccc atatggtccc accacatcat acgctacaca 901 cgacgggcat tccgcatccg gccatagtca caccaacagt caaacaggaa tcgtcccaga 961 gtgatgtcgg ctcactccat agttcaaagc atcaggactc caaaaaggaa gaagaaaaga 1021 agaagcccca cataaagaaa cctcttaatg cattcatgtt gtatatgaag gaaatgagag 1081 caaaggtcgt agctgagtgc acgttgaaag aaagcgcggc caTCAACCAG ATCCTTGGGC 1141 GGAGGTGGCA TGCACTGTCC AGAGAAGAGC AAGCGAAATA CTACGAGCTG GCCCGGAAGG 1201 AGCGACAGCT TCATATGCAA CTGTACCCCG GCTGGTCCGC GCGGGATAAC TATGGAAAGA 1261 AGAAGAAGAG GAAAAGGGAC AAGCAGCCGG GAGAGACCAA TGAACACAGC GAATGTTTCC 1321 TAAATCCTTG CCTTTCACTT CCTCCGATTA CAGGAGAAAA AAAAAGTGCG TTCGCTACAT 1381 ACAAGGTGAA GGCAGCTGCC TCAGCCCATC CTCTTCAGAT GGAAGCTTAC TACCCAACTT 1441 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1501 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1561 CTTGTGGAAA GGACGAGCCT CGCGGCGTGA CGATTTCTTC ACGCGTTAAG TCgacaatca 1621 acctctggat tacaaaattt gtgaaagatt