Transcript: Human NM_001350010.2

Homo sapiens RAB, member of RAS oncogene family like 2B (RABL2B), transcript variant 15, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
RABL2B (11158)
Length:
2179
CDS:
190..909

Additional Resources:

NCBI RefSeq record:
NM_001350010.2
NBCI Gene record:
RABL2B (11158)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350010.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435373 ACGCCTGCATCATGGTGTTTG pLKO_005 473 CDS 100% 10.800 6.480 N RABL2B n/a
2 TRCN0000048166 AGGACCATCCTTGTGGACTTT pLKO.1 391 CDS 100% 4.950 2.970 N RABL2B n/a
3 TRCN0000419979 TGCATCGTGGTGGCCAATAAA pLKO_005 571 CDS 100% 15.000 7.500 Y RABL2A n/a
4 TRCN0000429189 AGGACTTCATGGATGAGATTT pLKO_005 776 CDS 100% 13.200 6.600 Y RABL2B n/a
5 TRCN0000048164 TCCAAACTCATGGAGAGATTT pLKO.1 292 CDS 100% 13.200 6.600 Y RABL2B n/a
6 TRCN0000424085 AGAGGAGAGCTAGCAGATATG pLKO_005 2022 3UTR 100% 10.800 5.400 Y RABL2A n/a
7 TRCN0000048163 GCCTAGCTATAGTTAGGAATA pLKO.1 1838 3UTR 100% 10.800 5.400 Y RABL2B n/a
8 TRCN0000048112 CGATTAGCTGTGTCTTACAAA pLKO.1 745 CDS 100% 5.625 2.813 Y RABL2A n/a
9 TRCN0000048108 GCCTGCATCATGGTGTTTGAT pLKO.1 475 CDS 100% 5.625 2.813 Y RABL2A n/a
10 TRCN0000048109 CCAGGACTTCATGGATGAGAT pLKO.1 774 CDS 100% 4.950 2.475 Y RABL2A n/a
11 TRCN0000048167 TGATGACAACGTGAAGATCAT pLKO.1 243 CDS 100% 4.950 2.475 Y RABL2B n/a
12 TRCN0000048111 CAAGGGAAGTATGATGCTGAT pLKO.1 226 CDS 100% 4.050 2.025 Y RABL2A n/a
13 TRCN0000048165 GCAGACATAAACGTGACCCAA pLKO.1 598 CDS 100% 2.640 1.320 Y RABL2B n/a
14 TRCN0000048110 GTACGCCCTGACCCTGTACAA pLKO.1 348 CDS 100% 1.650 0.825 Y RABL2A n/a
15 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1670 3UTR 100% 5.625 2.813 Y KLHL30 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1670 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350010.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02634 pDONR223 100% 95.8% 95.8% None 505_534del n/a
2 ccsbBroad304_02634 pLX_304 0% 95.8% 95.8% V5 505_534del n/a
3 TRCN0000472616 CTCATTTTTGCCGTATCCGTGCAC pLX_317 77% 95.8% 95.8% V5 505_534del n/a
4 ccsbBroadEn_11605 pDONR223 100% 92.8% 92.4% None (many diffs) n/a
5 ccsbBroad304_11605 pLX_304 0% 92.8% 92.4% V5 (many diffs) n/a
6 TRCN0000468953 ATCGAGGGTCCACGTACCTGTACT pLX_317 56.6% 92.8% 92.4% V5 (many diffs) n/a
7 ccsbBroadEn_11606 pDONR223 100% 68.3% 67.3% None (many diffs) n/a
8 ccsbBroad304_11606 pLX_304 0% 68.3% 67.3% V5 (many diffs) n/a
9 TRCN0000477069 ACGCCCCACAATGCCGACATTTAC pLX_317 65.6% 68.3% 67.3% V5 (many diffs) n/a
10 ccsbBroadEn_11604 pDONR223 100% 41.4% 41.4% None 298_717del n/a
11 ccsbBroad304_11604 pLX_304 0% 41.4% 41.4% V5 298_717del n/a
12 TRCN0000471916 TGTCACCTTGGTTTGGGTTGGTTC pLX_317 100% 41.4% 41.4% V5 298_717del n/a
Download CSV