Transcript: Human NM_001350077.2

Homo sapiens polybromo 1 (PBRM1), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
PBRM1 (55193)
Length:
7987
CDS:
444..5291

Additional Resources:

NCBI RefSeq record:
NM_001350077.2
NBCI Gene record:
PBRM1 (55193)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350077.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235889 TCGCTACCGTCGGCTTGATTT pLKO_005 3038 CDS 100% 13.200 18.480 N PBRM1 n/a
2 TRCN0000015993 CCCTGATTATTACCAGCAAAT pLKO.1 1748 CDS 100% 10.800 15.120 N PBRM1 n/a
3 TRCN0000244326 TCACTAGACAGGCCCTAATTA pLKO_005 7357 3UTR 100% 15.000 12.000 N PBRM1 n/a
4 TRCN0000235890 CCGGAATGCCAGGCACTATAA pLKO_005 2324 CDS 100% 13.200 10.560 N PBRM1 n/a
5 TRCN0000015994 CCGGAGTCTTTGATCTACAAA pLKO.1 2763 CDS 100% 5.625 4.500 N PBRM1 n/a
6 TRCN0000235892 TGACTACTATCTGACTATTAA pLKO_005 2624 CDS 100% 15.000 10.500 N PBRM1 n/a
7 TRCN0000235891 AGTTAGGAGTTGTCGGAATAA pLKO_005 1673 CDS 100% 13.200 9.240 N PBRM1 n/a
8 TRCN0000015995 CCCATCTTCATTCACCCAGAA pLKO.1 4122 CDS 100% 4.050 2.835 N PBRM1 n/a
9 TRCN0000015997 GCAGCAAGTTATGCAGGCAAA pLKO.1 1925 CDS 100% 4.050 2.835 N PBRM1 n/a
10 TRCN0000015996 CCAGACTATTATGAAGTGGTT pLKO.1 741 CDS 100% 2.640 1.848 N PBRM1 n/a
11 TRCN0000374811 GAAGCAGAAAGCATCACTTTA pLKO_005 1611 CDS 100% 13.200 6.600 Y Scn8a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350077.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000472158 TCATGCCGTGGGTCGGGTCGCGAC pLX_317 7.9% 95.5% 95.5% V5 (many diffs) n/a
2 ccsbBroadEn_15888 pDONR223 0% 15.2% 15.2% None 1_4083del;4386_4387ins156 n/a
3 ccsbBroad304_15888 pLX_304 0% 15.2% 15.2% V5 1_4083del;4386_4387ins156 n/a
4 TRCN0000475263 TGTATTGCGATGGGCCACTCTCCT pLX_317 43.9% 15.2% 15.2% V5 1_4083del;4386_4387ins156 n/a
Download CSV