Transcript: Human NM_001350145.2

Homo sapiens PATJ crumbs cell polarity complex component (PATJ), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
PATJ (10207)
Length:
8655
CDS:
112..5760

Additional Resources:

NCBI RefSeq record:
NM_001350145.2
NBCI Gene record:
PATJ (10207)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350145.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236323 AGCGTCGAAGTTGGTATTAAA pLKO_005 4186 CDS 100% 15.000 21.000 N PATJ n/a
2 TRCN0000160681 CGATCACGCATGAGCATATTT pLKO.1 3886 CDS 100% 15.000 21.000 N PATJ n/a
3 TRCN0000236325 CGATCACGCATGAGCATATTT pLKO_005 3886 CDS 100% 15.000 21.000 N PATJ n/a
4 TRCN0000162664 CTCGACTGTATCTGGGTTATT pLKO.1 414 CDS 100% 13.200 18.480 N PATJ n/a
5 TRCN0000159109 GTACATAACAAGGCCAACAAA pLKO.1 3616 CDS 100% 5.625 7.875 N PATJ n/a
6 TRCN0000161817 CGTACATAACAAGGCCAACAA pLKO.1 3615 CDS 100% 4.950 6.930 N PATJ n/a
7 TRCN0000160184 CCTGATTATGAAGTAATGGTT pLKO.1 1720 CDS 100% 3.000 2.400 N PATJ n/a
8 TRCN0000158824 GCAAGAAGATTTGCCTTTATA pLKO.1 3141 CDS 100% 15.000 10.500 N PATJ n/a
9 TRCN0000236322 GTTGTAGCAGATACCAATATA pLKO_005 5383 CDS 100% 15.000 10.500 N PATJ n/a
10 TRCN0000236326 TGCAGATGACGGCCGATTAAA pLKO_005 5622 CDS 100% 15.000 10.500 N PATJ n/a
11 TRCN0000236324 CTCCGCTCACATGACTAATAC pLKO_005 8349 3UTR 100% 13.200 9.240 N PATJ n/a
12 TRCN0000159811 GAAACTAATGTGGATGGTGAA pLKO.1 1573 CDS 100% 4.050 2.835 N PATJ n/a
13 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 7392 3UTR 100% 4.950 2.475 Y ERAP2 n/a
14 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 7393 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350145.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11469 pDONR223 100% 62.3% 61.9% None (many diffs) n/a
2 ccsbBroad304_11469 pLX_304 0% 62.3% 61.9% V5 (many diffs) n/a
Download CSV