Transcript: Human NM_001350227.2

Homo sapiens inositol polyphosphate-5-phosphatase B (INPP5B), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
INPP5B (3633)
Length:
3891
CDS:
192..2273

Additional Resources:

NCBI RefSeq record:
NM_001350227.2
NBCI Gene record:
INPP5B (3633)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350227.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051674 GCGGGAACATACAATGTAAAT pLKO.1 336 CDS 100% 13.200 18.480 N INPP5B n/a
2 TRCN0000051677 GCTAGCATATTTGGCAGCTTA pLKO.1 2157 CDS 100% 4.950 6.930 N INPP5B n/a
3 TRCN0000359915 ATAAATCCAAGTCCGAAATTA pLKO_005 166 5UTR 100% 15.000 10.500 N INPP5B n/a
4 TRCN0000359852 TGTCGGACAAGGCTCATATTT pLKO_005 217 CDS 100% 15.000 10.500 N INPP5B n/a
5 TRCN0000305895 ATATTCTAGCTAGCATATTTG pLKO_005 2149 CDS 100% 13.200 9.240 N Inpp5b n/a
6 TRCN0000051673 GCCCAGATAATGGCTCAATAA pLKO.1 3382 3UTR 100% 13.200 9.240 N INPP5B n/a
7 TRCN0000051675 GCAGCCCACATTGAAGAGTAT pLKO.1 735 CDS 100% 4.950 3.465 N INPP5B n/a
8 TRCN0000051676 GCTCCCTGGATAAGATGGAAA pLKO.1 1261 CDS 100% 4.950 3.465 N INPP5B n/a
9 TRCN0000359851 GGATACTGGAATGATTGATAA pLKO_005 1892 CDS 100% 13.200 7.920 N INPP5B n/a
10 TRCN0000430981 GCCACCATGCCTGGCTAATTT pLKO_005 2990 3UTR 100% 15.000 7.500 Y GTF2IRD2 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3102 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3102 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350227.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.