Transcript: Human NM_001350495.1

Homo sapiens zinc finger protein 765 (ZNF765), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
ZNF765 (91661)
Length:
4461
CDS:
167..1579

Additional Resources:

NCBI RefSeq record:
NM_001350495.1
NBCI Gene record:
ZNF765 (91661)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350495.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148017 GAGAAACCTTACAGGTGTAAT pLKO.1 1893 3UTR 100% 13.200 6.600 Y ZNF813 n/a
2 TRCN0000150044 CCTTGAAAGACATAGGAGAAT pLKO.1 1531 CDS 100% 4.950 2.475 Y ZNF816 n/a
3 TRCN0000151709 CAAATGTAATGAGTGTGGCAA pLKO.1 2151 3UTR 100% 2.640 1.320 Y ZNF320 n/a
4 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4001 3UTR 100% 5.625 2.813 Y KLHL30 n/a
5 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 893 CDS 100% 4.950 2.475 Y ZNF28 n/a
6 TRCN0000148611 CGTAGACTTCATACTGGAGAA pLKO.1 875 CDS 100% 4.050 2.025 Y ZNF761 n/a
7 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4001 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350495.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05629 pDONR223 100% 30.3% 24.4% None (many diffs) n/a
2 ccsbBroad304_05629 pLX_304 0% 30.3% 24.4% V5 (many diffs) n/a
3 TRCN0000468214 TCTCTAGTACCTCAATAGGTGGTT pLX_317 94.7% 30.3% 24.4% V5 (many diffs) n/a
Download CSV