Transcript: Human NM_001350501.2

Homo sapiens transcription factor B1, mitochondrial (TFB1M), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
TFB1M (51106)
Length:
2625
CDS:
57..923

Additional Resources:

NCBI RefSeq record:
NM_001350501.2
NBCI Gene record:
TFB1M (51106)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350501.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021041 CCACGATTCGAGAAATCATTA pLKO.1 103 CDS 100% 13.200 18.480 N TFB1M n/a
2 TRCN0000423946 GCAATGTTCGACACATCTTTA pLKO_005 667 CDS 100% 13.200 18.480 N TFB1M n/a
3 TRCN0000021040 CGCAGAGAATTACAGACTCTA pLKO.1 902 CDS 100% 4.950 3.960 N TFB1M n/a
4 TRCN0000419578 CCTCCAAATGTACATATTATT pLKO_005 453 CDS 100% 15.000 10.500 N TFB1M n/a
5 TRCN0000428568 GAAGCAGCTATCACAGAATTT pLKO_005 146 CDS 100% 13.200 9.240 N TFB1M n/a
6 TRCN0000436664 GCTGACAGATAAGATTGTAAG pLKO_005 182 CDS 100% 10.800 7.560 N TFB1M n/a
7 TRCN0000021042 GCTGAACTTCTGGTGGTTGAA pLKO.1 291 CDS 100% 4.950 3.465 N TFB1M n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350501.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03207 pDONR223 100% 83.2% 83.2% None 790_791ins174 n/a
2 ccsbBroad304_03207 pLX_304 0% 83.2% 83.2% V5 790_791ins174 n/a
3 TRCN0000473484 ACTGCATTCTTTTGTGGAGTTTCA pLX_317 36% 83.2% 83.2% V5 790_791ins174 n/a
Download CSV