Transcript: Human NM_001350635.2

Homo sapiens family with sequence similarity 114 member A1 (FAM114A1), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
FAM114A1 (92689)
Length:
2567
CDS:
38..1432

Additional Resources:

NCBI RefSeq record:
NM_001350635.2
NBCI Gene record:
FAM114A1 (92689)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350635.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000135001 CTACGGATTCATGGTGTAAAT pLKO.1 515 CDS 100% 13.200 18.480 N FAM114A1 n/a
2 TRCN0000137767 GCCCTGGAAATTCTGTCCAAT pLKO.1 947 CDS 100% 4.950 3.465 N FAM114A1 n/a
3 TRCN0000138023 GCATTGTGATTCAGCTGCAGT pLKO.1 133 CDS 100% 2.640 1.848 N FAM114A1 n/a
4 TRCN0000136704 GATGCAGAAGTGCATTGTGAT pLKO.1 122 CDS 100% 0.495 0.347 N FAM114A1 n/a
5 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2195 3UTR 100% 5.625 2.813 Y KLHL30 n/a
6 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 2032 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
7 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 1958 3UTR 100% 0.495 0.248 Y C11orf44 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2195 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350635.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09348 pDONR223 100% 74.3% 68% None (many diffs) n/a
2 ccsbBroad304_09348 pLX_304 0% 74.3% 68% V5 (many diffs) n/a
3 TRCN0000474157 GGATTAAATGATAGTTATTCTTAC pLX_317 30% 74.3% 68% V5 (many diffs) n/a
4 ccsbBroadEn_09347 pDONR223 100% 74.1% 67.7% None (many diffs) n/a
5 ccsbBroad304_09347 pLX_304 0% 74.1% 67.7% V5 (many diffs) n/a
Download CSV