Transcript: Human NM_001350688.1

Homo sapiens KRIT1 ankyrin repeat containing (KRIT1), transcript variant 24, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
KRIT1 (889)
Length:
4524
CDS:
547..2757

Additional Resources:

NCBI RefSeq record:
NM_001350688.1
NBCI Gene record:
KRIT1 (889)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350688.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072879 CGGGTAGATAAAGTGGTAATA pLKO.1 1273 CDS 100% 13.200 18.480 N KRIT1 n/a
2 TRCN0000291540 CGGGTAGATAAAGTGGTAATA pLKO_005 1273 CDS 100% 13.200 18.480 N KRIT1 n/a
3 TRCN0000072882 GCCGTCTTCTCAGTGAAAGAT pLKO.1 1460 CDS 100% 5.625 4.500 N KRIT1 n/a
4 TRCN0000291593 GCCGTCTTCTCAGTGAAAGAT pLKO_005 1460 CDS 100% 5.625 4.500 N KRIT1 n/a
5 TRCN0000072881 GCCTTGGATAAGTGGTTAGAT pLKO.1 1021 CDS 100% 5.625 4.500 N KRIT1 n/a
6 TRCN0000291592 GCCTTGGATAAGTGGTTAGAT pLKO_005 1021 CDS 100% 5.625 4.500 N KRIT1 n/a
7 TRCN0000105937 CCTGTGTATGTAGGAGTGAAT pLKO.1 2515 CDS 100% 4.950 3.465 N Krit1 n/a
8 TRCN0000325212 CCTGTGTATGTAGGAGTGAAT pLKO_005 2515 CDS 100% 4.950 3.465 N Krit1 n/a
9 TRCN0000072880 CCAGTCTCAATTCTCGGGAAT pLKO.1 608 CDS 100% 4.050 2.835 N KRIT1 n/a
10 TRCN0000291595 CCAGTCTCAATTCTCGGGAAT pLKO_005 608 CDS 100% 4.050 2.835 N KRIT1 n/a
11 TRCN0000072878 CCCATTCTAAACAAGGGCATT pLKO.1 3658 3UTR 100% 4.050 2.835 N KRIT1 n/a
12 TRCN0000291594 CCCATTCTAAACAAGGGCATT pLKO_005 3658 3UTR 100% 4.050 2.835 N KRIT1 n/a
13 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 2938 3UTR 100% 4.950 2.475 Y ORAI2 n/a
14 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 2935 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350688.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00235 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00235 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476066 ATACCCCCAGCCGATTAGTACTCT pLX_317 16.2% 100% 100% V5 n/a
Download CSV