Transcript: Human NM_001350938.2

Homo sapiens zinc finger CCHC-type containing 8 (ZCCHC8), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ZCCHC8 (55596)
Length:
3837
CDS:
531..1940

Additional Resources:

NCBI RefSeq record:
NM_001350938.2
NBCI Gene record:
ZCCHC8 (55596)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350938.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075160 CGCCGAGAATCAAGAACTTAA pLKO.1 284 5UTR 100% 13.200 18.480 N ZCCHC8 n/a
2 TRCN0000229801 CTCGGAATGCTGCTCGAATAA pLKO_005 550 CDS 100% 13.200 18.480 N ZCCHC8 n/a
3 TRCN0000075159 GCGCCGAGAATCAAGAACTTA pLKO.1 283 5UTR 100% 5.625 7.875 N ZCCHC8 n/a
4 TRCN0000075162 CCAGGAGTTATTAGTGAGGAA pLKO.1 678 CDS 100% 2.640 3.696 N ZCCHC8 n/a
5 TRCN0000123780 GCCGAGAATCAAGAACTTAAA pLKO.1 285 5UTR 100% 13.200 10.560 N Zcchc8 n/a
6 TRCN0000331964 GCCGAGAATCAAGAACTTAAA pLKO_005 285 5UTR 100% 13.200 10.560 N Zcchc8 n/a
7 TRCN0000229802 GATTCAAGCCAGGAGTTATTA pLKO_005 670 CDS 100% 15.000 10.500 N ZCCHC8 n/a
8 TRCN0000229799 TAAGTTAGATGGACCTATATT pLKO_005 356 5UTR 100% 15.000 10.500 N ZCCHC8 n/a
9 TRCN0000219083 TTAGCACTGAGAGCTATTTAA pLKO_005 1950 3UTR 100% 15.000 10.500 N ZCCHC8 n/a
10 TRCN0000075158 GCTCACTAGTTCAGTATATTT pLKO.1 2101 3UTR 100% 0.000 0.000 N ZCCHC8 n/a
11 TRCN0000075161 CGCCATTTGAATTTGAGAATA pLKO.1 1828 CDS 100% 13.200 7.920 N ZCCHC8 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2852 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2852 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350938.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08549 pDONR223 100% 66.2% 66% None 0_1ins714;263C>T;784T>C n/a
2 ccsbBroad304_08549 pLX_304 0% 66.2% 66% V5 0_1ins714;263C>T;784T>C n/a
3 TRCN0000476906 GGACTTCTGGAAAGAATTGCAAAT pLX_317 15.4% 66.2% 66% V5 0_1ins714;263C>T;784T>C n/a
Download CSV