Transcript: Human NM_001350999.1

Homo sapiens zinc finger protein 789 (ZNF789), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
ZNF789 (285989)
Length:
1525
CDS:
193..1419

Additional Resources:

NCBI RefSeq record:
NM_001350999.1
NBCI Gene record:
ZNF789 (285989)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001350999.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107991 TCAGCTCTTACGGTCCATAAA pLKO.1 865 CDS 100% 13.200 18.480 N ZNF789 n/a
2 TRCN0000107992 GCAGGCTTACTTTCCCTACTA pLKO.1 557 CDS 100% 4.950 6.930 N ZNF789 n/a
3 TRCN0000107994 CGGCATTCAACCCTTCTATGT pLKO.1 1111 CDS 100% 4.950 3.465 N ZNF789 n/a
4 TRCN0000107993 CAGATATGATGAGGATGGCAA pLKO.1 660 CDS 100% 2.640 1.848 N ZNF789 n/a
5 TRCN0000107990 GCATCAAAGAATCCATACAAA pLKO.1 1215 CDS 100% 5.625 2.813 Y ZNF789 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001350999.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09988 pDONR223 100% 95.8% 95.5% None 0_1ins51;178A>G;763C>A n/a
2 ccsbBroad304_09988 pLX_304 0% 95.8% 95.5% V5 0_1ins51;178A>G;763C>A n/a
3 TRCN0000481345 AACGGGATAACACACAGCCGTAGC pLX_317 33.5% 95.8% 95.5% V5 0_1ins51;178A>G;763C>A n/a
Download CSV