Transcript: Human NM_001351062.1

Homo sapiens killer cell lectin like receptor D1 (KLRD1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
KLRD1 (3824)
Length:
3171
CDS:
174..713

Additional Resources:

NCBI RefSeq record:
NM_001351062.1
NBCI Gene record:
KLRD1 (3824)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351062.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416718 AGAACTGCATAGCGTATAATC pLKO_005 622 CDS 100% 13.200 18.480 N KLRD1 n/a
2 TRCN0000057409 CCGGTGCAACTGTTACTTCAT pLKO.1 377 CDS 100% 4.950 6.930 N KLRD1 n/a
3 TRCN0000057410 CCTTAGGGATAATATGCCTTT pLKO.1 217 CDS 100% 4.050 5.670 N KLRD1 n/a
4 TRCN0000421350 GAAATTCGTTCACCTACATTT pLKO_005 883 3UTR 100% 13.200 9.240 N KLRD1 n/a
5 TRCN0000434614 GACCCAACATTACTAACAATG pLKO_005 747 3UTR 100% 10.800 7.560 N KLRD1 n/a
6 TRCN0000057411 CCAGTATCTATTTCCATCATT pLKO.1 584 CDS 100% 5.625 3.938 N KLRD1 n/a
7 TRCN0000057408 CCCAACATAGAACTCCAGAAA pLKO.1 315 CDS 100% 4.950 3.465 N KLRD1 n/a
8 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 1853 3UTR 100% 4.950 2.475 Y ORAI2 n/a
9 TRCN0000148774 CCATGTGTTCTCATTGTTCAA pLKO.1 2904 3UTR 100% 4.950 2.475 Y GLIPR1L2 n/a
10 TRCN0000162188 CCATGTGTTCTCATTGTTCAA pLKO.1 2904 3UTR 100% 4.950 2.475 Y SPC25 n/a
11 TRCN0000166463 CCTGTGTCCATGTGTTCTCAT pLKO.1 2897 3UTR 100% 4.950 2.475 Y SPC25 n/a
12 TRCN0000149064 GCAGGTTTGTTACATAGGTAT pLKO.1 2736 3UTR 100% 4.950 2.475 Y GLIPR1L2 n/a
13 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 1814 3UTR 100% 4.050 2.025 Y P3H4 n/a
14 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 1814 3UTR 100% 4.050 2.025 Y ORAI2 n/a
15 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 1814 3UTR 100% 4.050 2.025 Y P3H4 n/a
16 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 1850 3UTR 100% 4.950 2.475 Y LOC339059 n/a
17 TRCN0000009295 GCAGGTTTGTTACATAGGTAA pLKO.1 2736 3UTR 100% 4.950 2.475 Y OR11A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351062.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00911 pDONR223 100% 99.8% 99.4% None 73T>G n/a
2 ccsbBroad304_00911 pLX_304 0% 99.8% 99.4% V5 73T>G n/a
Download CSV