Transcript: Human NM_001351610.1

Homo sapiens DNA polymerase iota (POLI), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Homo sapiens (human)
Gene:
POLI (11201)
Length:
5932
CDS:
69..2165

Additional Resources:

NCBI RefSeq record:
NM_001351610.1
NBCI Gene record:
POLI (11201)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351610.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415528 TCGGGTCATGTATACAATAAT pLKO_005 477 CDS 100% 15.000 21.000 N POLI n/a
2 TRCN0000422458 GATATTCAATAACGGAGTAAA pLKO_005 2256 3UTR 100% 13.200 18.480 N POLI n/a
3 TRCN0000437553 AGAGTCGTCAGTGCCCTATTC pLKO_005 1090 CDS 100% 10.800 15.120 N POLI n/a
4 TRCN0000053044 CCCGCTACAGAGAAATGTCTT pLKO.1 316 CDS 100% 4.950 6.930 N POLI n/a
5 TRCN0000415244 GAATAAGTCAAGGACCTAAAG pLKO_005 1840 CDS 100% 10.800 8.640 N POLI n/a
6 TRCN0000053047 GCCATAAGCAAACAGTAGCAA pLKO.1 1969 CDS 100% 3.000 2.400 N POLI n/a
7 TRCN0000425913 AGCAAGGGAATACCATTATTT pLKO_005 2191 3UTR 100% 15.000 10.500 N POLI n/a
8 TRCN0000053043 GCAACCTTAAAGCACTAAATA pLKO.1 1249 CDS 100% 15.000 10.500 N POLI n/a
9 TRCN0000434736 TACTGCCAACTAACCTATTAA pLKO_005 2584 3UTR 100% 15.000 10.500 N POLI n/a
10 TRCN0000435443 AGTGTCCACAGTTGGTATTAG pLKO_005 277 CDS 100% 13.200 9.240 N POLI n/a
11 TRCN0000435359 TGAAAGTTGTCAACATCTTAT pLKO_005 686 CDS 100% 13.200 9.240 N POLI n/a
12 TRCN0000425299 TGGTGGTTACCTGCAACTATG pLKO_005 202 CDS 100% 10.800 7.560 N POLI n/a
13 TRCN0000053045 CCAGATTCTGTTGATGAGAAA pLKO.1 2025 CDS 100% 4.950 3.465 N POLI n/a
14 TRCN0000053046 CCTCAGTCCTTTAGTGAAGAA pLKO.1 912 CDS 100% 4.950 3.465 N POLI n/a
15 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3582 3UTR 100% 5.625 2.813 Y KLHL30 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3582 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351610.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11612 pDONR223 100% 90.9% 90.9% None 1_75del;114_115ins126 n/a
2 ccsbBroad304_11612 pLX_304 0% 90.9% 90.9% V5 1_75del;114_115ins126 n/a
3 TRCN0000470567 TACGATTCACGACTCTGAGCCCAA pLX_317 20.7% 90.9% 90.9% V5 1_75del;114_115ins126 n/a
Download CSV