Transcript: Human NM_001351728.2

Homo sapiens Rap guanine nucleotide exchange factor 2 (RAPGEF2), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
RAPGEF2 (9693)
Length:
7004
CDS:
348..4970

Additional Resources:

NCBI RefSeq record:
NM_001351728.2
NBCI Gene record:
RAPGEF2 (9693)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351728.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036987 CCATACAATGATATTGGGATT pLKO.1 1992 CDS 100% 4.050 5.670 N RAPGEF2 n/a
2 TRCN0000336859 CTTGATCTCATTGGGATAATG pLKO_005 5368 3UTR 100% 13.200 10.560 N RAPGEF2 n/a
3 TRCN0000036985 CGCAACATTGAACCTACTGAA pLKO.1 2547 CDS 100% 4.950 3.960 N RAPGEF2 n/a
4 TRCN0000336916 ACAGCTCTCTATGCGAAATTT pLKO_005 2516 CDS 100% 15.000 10.500 N RAPGEF2 n/a
5 TRCN0000336955 CAACTGAGTGGAAGGTATTAT pLKO_005 2385 CDS 100% 15.000 10.500 N RAPGEF2 n/a
6 TRCN0000239102 GATCAGTAGATAAACGTAAAT pLKO_005 6433 3UTR 100% 13.200 9.240 N Rapgef2 n/a
7 TRCN0000336917 TAAGGTTACACGGGTAGTATT pLKO_005 1328 CDS 100% 13.200 9.240 N RAPGEF2 n/a
8 TRCN0000336858 TGATTGAACCTGATCAGTATA pLKO_005 4051 CDS 100% 13.200 9.240 N RAPGEF2 n/a
9 TRCN0000036984 CCAGCAAGATTACTGCCGTAT pLKO.1 1028 CDS 100% 4.050 2.835 N RAPGEF2 n/a
10 TRCN0000036986 CGGACCATGATTGAACCTGAT pLKO.1 4044 CDS 100% 4.050 2.835 N RAPGEF2 n/a
11 TRCN0000239101 AGCAAGATTACTGCCGTATTT pLKO_005 1030 CDS 100% 13.200 18.480 N Rapgef2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351728.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.