Transcript: Human NM_001351836.1

Homo sapiens ATM serine/threonine kinase (ATM), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
ATM (472)
Length:
622
CDS:
189..527

Additional Resources:

NCBI RefSeq record:
NM_001351836.1
NBCI Gene record:
ATM (472)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351836.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038655 GCCGTCAACTAGAACATGATA pLKO.1 223 CDS 100% 5.625 4.500 N ATM n/a
2 TRCN0000245106 GCCGTCAACTAGAACATGATA pLKO_005 223 CDS 100% 5.625 4.500 N ATM n/a
3 TRCN0000245107 CGAGATCCTGAAACAATTAAA pLKO_005 291 CDS 100% 15.000 10.500 N ATM n/a
4 TRCN0000245108 TGGTCAAATACTTCATCAAAT pLKO_005 487 CDS 100% 13.200 9.240 N ATM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351836.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10688 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_10688 pLX_304 97.4% 100% 100% V5 n/a
3 TRCN0000491887 TGGTATTGATTCTCGAAGGTGCCG pLX_317 91.8% 100% 100% V5 n/a
Download CSV