Transcript: Human NM_001351861.1

Homo sapiens PPFIA binding protein 2 (PPFIBP2), transcript variant 12, mRNA.

Source:
NCBI, updated 2019-06-04
Taxon:
Homo sapiens (human)
Gene:
PPFIBP2 (8495)
Length:
3771
CDS:
825..3224

Additional Resources:

NCBI RefSeq record:
NM_001351861.1
NBCI Gene record:
PPFIBP2 (8495)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351861.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116154 GCTGCATGTCAACAAGTTCAA pLKO.1 2660 CDS 100% 4.950 6.930 N PPFIBP2 n/a
2 TRCN0000122435 GAAGATAAGGACCGTCGGATA pLKO.1 1473 CDS 100% 4.050 5.670 N PPFIBP2 n/a
3 TRCN0000296068 GATAAGGAGTCCCTCATATTG pLKO_005 942 CDS 100% 13.200 9.240 N PPFIBP2 n/a
4 TRCN0000116152 GCAGAGAATATTCCAGCAATT pLKO.1 3324 3UTR 100% 10.800 7.560 N PPFIBP2 n/a
5 TRCN0000288875 GCAGAGAATATTCCAGCAATT pLKO_005 3324 3UTR 100% 10.800 7.560 N PPFIBP2 n/a
6 TRCN0000116153 CCTGGCTCAGTATGTGATCTT pLKO.1 2306 CDS 100% 4.950 3.465 N PPFIBP2 n/a
7 TRCN0000116155 GCTACAAATAAGGACCCTGAA pLKO.1 1623 CDS 100% 4.050 2.835 N PPFIBP2 n/a
8 TRCN0000308073 TACCTAACTGTGAACGATTTA pLKO_005 2580 CDS 100% 0.000 0.000 N PPFIBP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351861.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07245 pDONR223 100% 90.5% 89.5% None (many diffs) n/a
2 ccsbBroad304_07245 pLX_304 0% 90.5% 89.5% V5 (many diffs) n/a
3 TRCN0000491463 ACCCCGGAACCGCCACCCGCAATG pLX_317 10.6% 90.5% 89.5% V5 (many diffs) n/a
Download CSV