Transcript: Human NM_001352138.1

Homo sapiens zinc finger protein 415 (ZNF415), transcript variant 14, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
ZNF415 (55786)
Length:
2542
CDS:
326..2029

Additional Resources:

NCBI RefSeq record:
NM_001352138.1
NBCI Gene record:
ZNF415 (55786)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001352138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364648 GTGCATGTTGAAGCTATTAAC pLKO_005 2341 3UTR 100% 13.200 18.480 N ZNF415 n/a
2 TRCN0000364650 TTAGTGTGCATTCGAACTTAA pLKO_005 1707 CDS 100% 13.200 18.480 N ZNF415 n/a
3 TRCN0000020959 CGCGTCATTGGAGAGTTCATA pLKO.1 1140 CDS 100% 5.625 7.875 N ZNF415 n/a
4 TRCN0000020961 GTCTCGTAACTGTGTAATCAA pLKO.1 502 CDS 100% 5.625 7.875 N ZNF415 n/a
5 TRCN0000020960 CCTCTTCAGACATCAAATTAT pLKO.1 1975 CDS 100% 15.000 10.500 N ZNF415 n/a
6 TRCN0000369295 CTCTACACAGAGGACTTTATA pLKO_005 335 CDS 100% 15.000 10.500 N ZNF415 n/a
7 TRCN0000369293 TCTGGAGAGAAAGGATATAAA pLKO_005 1076 CDS 100% 15.000 10.500 N ZNF415 n/a
8 TRCN0000364649 GGTATAGGAAACAAGTCTATT pLKO_005 746 CDS 100% 13.200 9.240 N ZNF415 n/a
9 TRCN0000020963 GAGTGCGACAAAGCCTTGAAT pLKO.1 1019 CDS 100% 5.625 3.938 N ZNF415 n/a
10 TRCN0000020962 CGAAATTCATGCCTTGCACTA pLKO.1 1292 CDS 100% 4.050 2.835 N ZNF415 n/a
11 TRCN0000369294 TGCTAAAGAGAAATCATATAC pLKO_005 2240 3UTR 100% 13.200 7.920 N ZNF415 n/a
12 TRCN0000151709 CAAATGTAATGAGTGTGGCAA pLKO.1 1849 CDS 100% 2.640 1.320 Y ZNF320 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001352138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12274 pDONR223 100% 92.6% 88.9% None (many diffs) n/a
2 ccsbBroad304_12274 pLX_304 0% 92.6% 88.9% V5 (many diffs) n/a
3 TRCN0000475724 CTCCGCAAGCTAGGATTTTGTAAC pLX_317 21.9% 92.6% 88.9% V5 (many diffs) n/a
Download CSV