Transcript: Human NM_001352250.2

Homo sapiens solute carrier family 5 member 11 (SLC5A11), transcript variant 16, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
SLC5A11 (115584)
Length:
2318
CDS:
282..2228

Additional Resources:

NCBI RefSeq record:
NM_001352250.2
NBCI Gene record:
SLC5A11 (115584)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001352250.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072792 CTGGCTGTACTCTACCTATTT pLKO.1 714 CDS 100% 13.200 18.480 N SLC5A11 n/a
2 TRCN0000072788 GCATCCTTGTTTGCCAGCAAT pLKO.1 495 CDS 100% 4.950 3.465 N SLC5A11 n/a
3 TRCN0000072790 CGGGCATTTCTGTATCAGCTT pLKO.1 562 CDS 100% 2.640 1.848 N SLC5A11 n/a
4 TRCN0000072791 CGGCCAGCTCTTCATCTATAT pLKO.1 1532 CDS 100% 13.200 7.920 N SLC5A11 n/a
5 TRCN0000072789 GCCATCATAGTTTCCCTGGAA pLKO.1 2121 CDS 100% 2.640 1.584 N SLC5A11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001352250.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489726 ATTTAATATAAGCCTCAACCCCCG pLX_317 18.9% 96% 96% V5 (not translated due to prior stop codon) 583_584ins81 n/a
2 ccsbBroadEn_13051 pDONR223 100% 86.4% 86.3% None (many diffs) n/a
3 ccsbBroad304_13051 pLX_304 0% 86.4% 86.3% V5 (many diffs) n/a
4 TRCN0000470165 GAGTAGCGTAGTCTAATTGCCGTA pLX_317 23.6% 86.4% 86.3% V5 (many diffs) n/a
Download CSV