Transcript: Human NM_001352268.1

Homo sapiens ribosomal modification protein rimK like family member B (RIMKLB), transcript variant 5, mRNA.

Source:
NCBI, updated 2018-06-15
Taxon:
Homo sapiens (human)
Gene:
RIMKLB (57494)
Length:
4774
CDS:
207..1367

Additional Resources:

NCBI RefSeq record:
NM_001352268.1
NBCI Gene record:
RIMKLB (57494)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001352268.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140577 GCGGATCAATGGAGAGCTAAT pLKO.1 386 CDS 100% 10.800 15.120 N RIMKLB n/a
2 TRCN0000144733 GCTGATCTAAGCCATCTTATT pLKO.1 738 CDS 100% 13.200 10.560 N RIMKLB n/a
3 TRCN0000140009 GCTGACAATCGAGCAAGGAAA pLKO.1 356 CDS 100% 4.950 3.465 N RIMKLB n/a
4 TRCN0000139503 CTGAAGTTCTGGAGTTCCCAA pLKO.1 649 CDS 100% 2.640 1.848 N RIMKLB n/a
5 TRCN0000140297 GATGAAAGATGACGGCTCCTT pLKO.1 1004 CDS 100% 2.640 1.848 N RIMKLB n/a
6 TRCN0000140736 GCTCATTGAGTGAACAAGGGA pLKO.1 922 CDS 100% 0.750 0.525 N RIMKLB n/a
7 TRCN0000122756 CGGTTAATGAACCGACCTCAA pLKO.1 507 CDS 100% 0.405 0.284 N RIMKLB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001352268.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12352 pDONR223 100% 74.2% 73.9% None (many diffs) n/a
2 ccsbBroad304_12352 pLX_304 0% 74.2% 73.9% V5 (many diffs) n/a
3 TRCN0000472196 TGGTCCTCCGCTTATAAGAGGATC pLX_317 57.9% 74.2% 73.9% V5 (many diffs) n/a
Download CSV