Transcript: Human NM_001352480.1

Homo sapiens zinc finger protein 248 (ZNF248), transcript variant 16, mRNA.

Source:
NCBI, updated 2018-06-15
Taxon:
Homo sapiens (human)
Gene:
ZNF248 (57209)
Length:
3357
CDS:
480..839

Additional Resources:

NCBI RefSeq record:
NM_001352480.1
NBCI Gene record:
ZNF248 (57209)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001352480.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232295 TTGTAGGTTGGCCAGTATATG pLKO_005 1692 3UTR 100% 13.200 18.480 N ZNF248 n/a
2 TRCN0000017466 GTGATCTTTAAGATCGAGCAA pLKO.1 645 CDS 100% 2.640 3.696 N ZNF248 n/a
3 TRCN0000232291 CTAAACCAGAAGTGATCTTTA pLKO_005 634 CDS 100% 13.200 7.920 N ZNF248 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001352480.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15944 pDONR223 0% 92.7% 91.5% None 73C>G;331_334delTGGAinsC;337_357del n/a
2 ccsbBroadEn_03807 pDONR223 100% 20.4% 19.1% None (many diffs) n/a
3 ccsbBroad304_03807 pLX_304 0% 20.4% 19.1% V5 (many diffs) n/a
4 TRCN0000469632 CGTATGCCGATTTTCACCGCCAAC pLX_317 26.7% 20.4% 19.1% V5 (many diffs) n/a
Download CSV