Transcript: Human NM_001352493.2

Homo sapiens zinc finger protein 248 (ZNF248), transcript variant 29, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ZNF248 (57209)
Length:
3902
CDS:
454..789

Additional Resources:

NCBI RefSeq record:
NM_001352493.2
NBCI Gene record:
ZNF248 (57209)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001352493.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017466 GTGATCTTTAAGATCGAGCAA pLKO.1 619 CDS 100% 2.640 3.696 N ZNF248 n/a
2 TRCN0000232291 CTAAACCAGAAGTGATCTTTA pLKO_005 608 CDS 100% 13.200 7.920 N ZNF248 n/a
3 TRCN0000146346 CCTCAGAATGTGACTGTATTT pLKO.1 3630 3UTR 100% 13.200 6.600 Y VNN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001352493.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15944 pDONR223 0% 99.6% 99% None 73C>G n/a
2 ccsbBroadEn_03807 pDONR223 100% 19% 18.9% None 331_332delCAinsG;333_334ins1405 n/a
3 ccsbBroad304_03807 pLX_304 0% 19% 18.9% V5 331_332delCAinsG;333_334ins1405 n/a
4 TRCN0000469632 CGTATGCCGATTTTCACCGCCAAC pLX_317 26.7% 19% 18.9% V5 331_332delCAinsG;333_334ins1405 n/a
Download CSV